Previous Contig 012211:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF044I17Sequence628012211 (6)gb:AC005623_15328527e-77Arabidopsis thaliana chromosome 2 clone T20P8 map B68, complete sequence.>gb:AY0634012211 (6)gb:AC005623_15328522e-33Arabidopsis thaliana chromosome 2 clone T20P8 map B68, complete sequence.>gb:AY0
JMFN008E17Sequence470012211 (6)gb:AP006447_18618022e-10Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:B110
JMFS026H01Sequence627012211 (6)gb:AC005623_15328521e-38Arabidopsis thaliana chromosome 2 clone T20P8 map B68, complete sequence.>gb:AY0
JMSF012B06Sequence359003684 (63)gb:AC005623_15328523e-13Arabidopsis thaliana chromosome 2 clone T20P8 map B68, complete sequence.>gb:AY0771012211 (6)gb:AC005623_15328527e-72Arabidopsis thaliana chromosome 2 clone T20P8 map B68, complete sequence.>gb:AY0
JMSF021K09Sequence629003684 (63)gb:AC005623_15328524e-43Arabidopsis thaliana chromosome 2 clone T20P8 map B68, complete sequence.>gb:AY0807012211 (6)gb:AC005623_15328521e-79Arabidopsis thaliana chromosome 2 clone T20P8 map B68, complete sequence.>gb:AY0

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN008E17+ GGTAGAACCAAGTC
rJMFF044I17- CCTTATGGCGGATCACCCTGGAGAGTTTTTTTTTTTTTTTTAGGTAGAACCAAGTC
JMFS026H01+ TTAGGTAGAACCAAGTC
                      ____________________________________________________________
consensus CCTTATGGCGGATCACCCTGGAGAGTTTTTTTTTTTTTTTTAGGTAGAACCAAGTC
 
. : . : . : . : . : . :
JMFN008E17+ CTTAAAATAAACCACACTCCGACAGCAAGTTAAGTGGAGTCACATACTCCCCCTCCCCAT
rJMFF044I17- CTTAAAATAAACCACACTCCGACAGCAAGTTAAGTGGAGTCACATACTCCCCCTCCCCAT
JMFS026H01+ CTTAAAATAAACCACACTCCGACAGCAAGTTAAGTGGAGTCACATACTCCCCCTCCCCAT
rJMSF012B06- AGTGGAGTCACATACTCCCCCTCCCCAT
rJMSF021K09- GTGGAGTCACATACTCCCCCTCCCCAT
                      ____________________________________________________________
consensus CTTAAAATAAACCACACTCCGACAGCAAGTTAAGTGGAGTCACATACTCCCCCTCCCCAT
 
. : . : . : . : . : . :
JMFN008E17+ CCATACAACAAATAATGTCTTCCAAAACATTTGCATGGGAGGGGAGGGACAACCATAAAA
rJMFF044I17- CCATACAACAAATAATGTCTTCCAAAACATTTGCATGGGAGGGGAGGGACAACCATAAAA
JMFS026H01+ CCATACAACAAATAATGTCTTCCAAAACATTTGCATGGGAGGGGAGGGACAACCATAAAA
rJMSF012B06- CCATACAACAAATAATGTCTTCCAAAACATTTGCATGGGAGGGGAGGGACAACCATAAAA
rJMSF021K09- CCATACAACAAATAATGTCTTCCAAAACATTTGCATGGGAGGGGAGGGACAACCNTAAAA
                      ____________________________________________________________
consensus CCATACAACAAATAATGTCTTCCAAAACATTTGCATGGGAGGGGAGGGACAACCATAAAA
 
. : . : . : . : . : . :
JMFN008E17+ AGTTAAAGAGCAGTACAGCCTAAAACAGTCTTAAACTTGGTCTGATCTGGTCTGGTCAAC
rJMFF044I17- AGTTAAAGAGCAGTACAGCCTAAAACAGTCTTAAACTTGGTCTGATCTGGTCTGGTCAAC
JMFS026H01+ AGTTAAAGAGCAGTACAGCCTAAAACAGTCTTAAACTTGGTCTGATCTGGTCTGGTCAAC
rJMSF012B06- AGTTAAAGAGCAGTACAGCCTAAAACAGTCTTAAACTTGGTCTGATCTGGTCTGGTCAAC
JMFF044I17+ AC
rJMSF021K09- AGTTAAAGAGCAGTACAGCCTAAAACAGTCTTAAACTTGGTCTGATCTGGTCTGGTCAAC
                      ____________________________________________________________
consensus AGTTAAAGAGCAGTACAGCCTAAAACAGTCTTAAACTTGGTCTGATCTGGTCTGGTCAAC
 
. : . : . : . : . : . :
JMFN008E17+ CGCATAATAACCCATACTTGAAACTATATTTACAATCCATTCACTGTAACAAGCAGGCAC
rJMFF044I17- CGCATAATAACCCATACTTGAAACTATATTTACAATCCATTCACTGTAACAAGCAGGCAC
JMFS026H01+ CGCATAATAACCCATACTTGAAACTATATTTACAATCCATTCACTGTAACAAGCAGGCAC
rJMSF012B06- CGCATAATAACCCATACTTGAAACTATATTTACAATCCATTCACTGTAACAAGCAGGCAC
JMFF044I17+ CGCATAATAACCCATACTTGAAACTATATTTACAATCCATTCACTGTAACAAGCAGGCAC
rJMSF021K09- CGCATAATAACCCATACTTGAAACTATATTTACAATCCATTCACTGTAACAAGCAGGCAC
                      ____________________________________________________________
consensus CGCATAATAACCCATACTTGAAACTATATTTACAATCCATTCACTGTAACAAGCAGGCAC
 
. : . : . : . : . : . :
JMFN008E17+ GCAGCCTTTTTAACAGAAGAACATTGAACTGGACACTTTCTCCTCCAGCTTAGGCAACTG
rJMFF044I17- GCAGCCTTTTTAACAGAAGAACATTGAACTGGACACTTTCTCCTCCAGCTTAGGCAACTG
JMFS026H01+ GCAGCCTTTTTAACAGAAGAACATTGAACTGGACACTTTCTCCTCCAGCTTAGGCAACTG
rJMSF012B06- GCAGCCTTTTTAACAGAAGAACATTGAACTGGACACTTTCTCCTCCAGCTTAGGCAACTG
JMFF044I17+ GCAGCC-TTTTAACAGAAGAACATTGAACTGGACACTTTCTCCTCCAGCTTAGGCAACTG
rJMSF021K09- GCAGCCTTTTTAACAGAAGAACATTGAACTGGACACTTTCTCCTCCAGCTTAAGCAACTG
                      ____________________________________________________________
consensus GCAGCCTTTTTAACAGAAGAACATTGAACTGGACACTTTCTCCTCCAGCTTAGGCAACTG
 
. : . : . : . : . : . :
JMFN008E17+ AGGAACAGGAGCTGGACCACCATTCTTCCCACCACCACCACCGGGGTTTGAAGATGTGTC
rJMFF044I17- AGGAACAGGAGCTGGACCACCATTCTTCCCACCACCACCACCGGGGTTTGAAGATGTGTC
JMFS026H01+ AGGAACAGGAGCTGGACCACCATTCTTCCCACCACCACCACCGGGGTTTGAAGATGTGTC
rJMSF012B06- AGGAACAGGAGCTGGACCACCATTCTTCCCACCACCACCACCGGGGTTTGAAGATGTGTC
JMFF044I17+ AGGAACAGGAGCTGGACCACCATTCTTCCCACCACCACCACCGGGGTTTGAAGATGTGTC
rJMSF021K09- ANGAACAGGAGCTGGACCACCATTCTTCCCACCACCACCACCGGGGTTTGAAGATGTGTC
                      ____________________________________________________________
consensus AGGAACAGGAGCTGGACCACCATTCTTCCCACCACCACCACCGGGGTTTGAAGATGTGTC
 
. : . : . : . : . : . :
JMFN008E17+ AGATGAGCCCTCAAATTTCATCCATTGTCCCAACTGGGTCGCAGCCAAATGAGCATAGCA
rJMFF044I17- AGATGAGCCCTCAAATTTCATCCATTGTCCCAACTGGGTCGCAGCCAAATGAGCATAGCA
JMFS026H01+ AGATGAGCCCTCAAATTTCATCCATTGTCCCAACTGGGTCGCAGCCAAATGAGCATAGCA
rJMSF012B06- AGATGAGCCCTCAAATTTCATCCATTGTCCCAACTGGGTCGCAGCCAAATGAGCATAGCA
JMFF044I17+ AGATGAGCCCTCAAATTTCATCCATTGTCCCAACTGGGTCGCAGCCAAATGAGCATAGCA
rJMSF021K09- AGATGAGCCCTCAAATTTCATCCATTGTCCCAACTGGGTCGCANCCAAATGAGCATAGCA
                      ____________________________________________________________
consensus AGATGAGCCCTCAAATTTCATCCATTGTCCCAACTGGGTCGCAGCCAAATGAGCATAGCA
 
. : . : . : . : . : . :
JMFN008E17+ TATTGGGGCAACAACTGATATGGCAGTGGTGCTTCG
rJMFF044I17- TATTGGGGCAACAACTGATATGGCAGTGGTGCTTCGTTGGTACACATAGGATAAGTTGTG
JMFS026H01+ TATTGGGGCAACAACTGATATGGCAGTGGTGCTTCGTTGGTACACATAGGATAAGTTGTG
rJMSF012B06- TATTGGGGCAACAACTGATATGGCAGTGGTGCTTCGTTGGTACACATAGGATAAGTTGTG
JMFF044I17+ TATTGGGGCAACAACTGATATGGCAGTGGTGCTTCGTTGGTACACATAGGATAAGTTGTG
rJMSF021K09- TATTGGGGCAACAACTGATATGGCAGTGGTGCTTCGTTGGTACACATAGGATAAGTTGTG
                      ____________________________________________________________
consensus TATTGGGGCAACAACTGATATGGCAGTGGTGCTTCGTTGGTACACATAGGATAAGTTGTG
 
. : . : . : . : . : . :
rJMFF044I17- CACAAGTTCTTGTAGCTCATCTGCAGAAAACCCAACCTCATCCAGAAGAACATGGTAATG
JMFS026H01+ CACAAGTTCTTGTAGCTCATCTGCAGAAAACCCAACCTCATCCAGAAGAACATGGTAATG
rJMSF012B06- CACAAGTTCTTGTAGCTCATCTGCAGAAAACCCAACCTCATCCAGAAGAACATGGTAATG
JMFF044I17+ CACAAGTTCTTGTAGCTCATCTGCAGAAAACCCAACCTCATCCAGAAGAACATGGTAATG
rJMSF021K09- CACAAGTTCTTGTAGCTCATCTGCAGAANACCCNACCTCATCCAGAAAAACATGGTAATG
                      ____________________________________________________________
consensus CACAAGTTCTTGTAGCTCATCTGCAGAAAACCCAACCTCATCCAGAAGAACATGGTAATG
 
. : . : . : . : . : . :
rJMFF044I17- AGTTGGTCTTGTGGTCCCAATCATTCCTGCATGGGCAC
JMFS026H01+ AGTTGGTCTTGTGGTCCCAATCATTCCTGCATGGGCACACAAGTAGAAGTCATTGTTCCT
rJMSF012B06- AGTTGGTCTTGTGGTCCCAATCATTCCTGCATGGGCACACAAGTAGAAGTCATTGTTCCT
JMFF044I17+ AGTTGGTCTTGTGGTCCCAATCATTCCTGCATGGGCACACAAGTAGAAGTCATTGTTCCT
rJMSF021K09- AGTTGGTCTTGTGGTCCCAATCATTCCTGCATGGGCACACAAGTAGAAGTCATTGTTCCT
                      ____________________________________________________________
consensus AGTTGGTCTTGTGGTCCCAATCATTCCTGCATGGGCACACAAGTAGAAGTCATTGTTCCT
 
. : . : . : . : . : . :
JMFS026H01+ AG
rJMSF012B06- AGGATGGCAAACTTTATTGTCTATGATTGTCCCTGGTGGAACATTATCANGAGACGAAGA
JMFF044I17+ AGGATGGCAAACTTTATTGTCTATGATTGTCCCTGGTGGAACATTATCAGGAGACGAAGA
rJMSF021K09- AGGATGGCAAACTTTATTGTCTATGATTGTCCCTGGTGGAACATTATCAGGAGACGAAGA
                      ____________________________________________________________
consensus AGGATGGCAAACTTTATTGTCTATGATTGTCCCTGGTGGAACATTATCAGGAGACGAAGA
 
. : . : . : . : . : . :
rJMSF012B06- CTGAAAGAACTTAGTATGATGATTCTTCTGAGCAATAATAACCACAAACTTGGGTGACCA
JMFF044I17+ CTGAAAGAACTTAGTATGATGATTCTTCTGAGCAATAATAACCACAAACTTGGGTGACCA
rJMSF021K09- CTGAAAGAACTTAGTATGATGATTCTTCTGAGCAATAATAACCACAAACTTGGGTGACCA
                      ____________________________________________________________
consensus CTGAAAGAACTTAGTATGATGATTCTTCTGAGCAATAATAACCACAAACTTGGGTGACCA
 
. : . : . : . : . : . :
rJMSF012B06- TTTCTCGTCAAGAAATTTGCNAGCCTCAATGATCTGATCAAGCTCAATATTCAGTACTTG
JMFF044I17+ TTTCTCGTCAAGAAATTTGCAAGCCTCAATGATCTGATCAAGCTCAATATTCAGTACTTG
rJMSF021K09- TTTCTCGTCNAGAAATTTGCAAGCCTCAATGATCTGATCAAGCTCAATATTCAGTACTTG
                      ____________________________________________________________
consensus TTTCTCGTCAAGAAATTTGCAAGCCTCAATGATCTGATCAAGCTCAATATTCAGTACTTG
 
. : . : . : . : . : . :
rJMSF012B06- ATTGAATNGGGATTCNCTGAC
JMFF044I17+ ATTGAATTGGGATTCACTGAC
rJMSF021K09- ATTGAATTGGGATTCACTGACACCATCCCTGAAGATTATGATTNGATCAGGCTTCCTTTT
                      ____________________________________________________________
consensus ATTGAATTGGGATTCACTGACACCATCCCTGAAGATTATGATTNGATCAGGCTTCCTTTT