Previous Contig 012209:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF004O21Sequence279004654 (2)302012209 (5)
JMSF021J18Sequence666007470 (5)gb:AC079131_17323691e-10Arabidopsis thaliana chromosome 1 BAC T18I24 genomic sequence, complete sequence640012209 (5)gb:BT001018_16352732e-06Arabidopsis thaliana At5g10490/F12B17_160 mRNA, complete cds.>gb:AF412044_179729
JMSF028O12Sequence719007470 (5)623012209 (5)gb:AF275345_17825257e-07Lycopersicon esculentum putative permease gene, partial cds; suppressor-like pro
JMSF039J04Sequence664020024gb:AC079131_17323691e-15Arabidopsis thaliana chromosome 1 BAC T18I24 genomic sequence, complete sequence585012209 (5)gb:BT001018_16352733e-06Arabidopsis thaliana At5g10490/F12B17_160 mRNA, complete cds.>gb:AF412044_179729
JMSF042B08Sequence459007470 (5)561012209 (5)gb:BT001018_16352732e-06Arabidopsis thaliana At5g10490/F12B17_160 mRNA, complete cds.>gb:AF412044_179729

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF042B08+ TNTGNCGATTNGGTTCAAAG
                      ____________________________________________________________
consensus TNTGNCGATTNGGTTCAAAG
 
. : . : . : . : . : . :
rJMSF042B08+ TAAAANNGAGAGGCAGCAGCAAGTTGNCAAGGTAGTTNCCGGGGAGGCATTGGTTGTCCC
                      ____________________________________________________________
consensus TAAAANNGAGAGGCAGCAGCAAGTTGNCAAGGTAGTTNCCGGGGAGGCATTGGTTGTCCC
 
. : . : . : . : . : . :
rJMSF028O12+ TAGATGCACCTTCGGGTGTTCCACAGGCAAAACAAGACGG
rJMSF042B08+ NGAANTGAGCGCCGAGAAGATAGATGCACNTTCGGGTGTTCCACAGGCAAAACAAGACGG
                      ____________________________________________________________
consensus NGAANTGAGCGCCGAGAAGATAGATGCACCTTCGGGTGTTCCACAGGCAAAACAAGACGG
 
. : . : . : . : . : . :
rJMSF028O12+ TGGTGAAAGACCCGCCCCAGCGCCATCTCAGGCTGTGGCGAGGCCAACGCTAGAGGAGAA
rJMSF042B08+ TGGTGAAAGACCCGCCCCAGCGCCATCTCAGGCTGTGGCGAGGCCAACGCTAGAGGAGAA
rJMSF039J04+ CCATTTCAGGCTGTGGCGAGGCCAACGCTAGAGGAGAA
rJMSF021J18+ CCATCTCAGGCTGTGGCGAGGCCAACGCTAGAGGAGAA
                      ____________________________________________________________
consensus TGGTGAAAGACCCGCCCCAGCGCCATCTCAGGCTGTGGCGAGGCCAACGCTAGAGGAGAA
 
. : . : . : . : . : . :
rJMSF028O12+ CATACTTCTCGGCGTTGCACTCGAAGGATCAAAGCGCACGCTCCCGATTGAAGAAGAAAT
rJMSF042B08+ CATACTTCTCGGCGTTGCACTCGAAGGATCAAAGCGCACGCTCCCGATTGAAGAAGAAAT
rJMSF039J04+ CATACTTCTCGGCGTTGCACTCGAAGGATCAAAGCGCACGCTCCCGATTGAAGAAGAAAT
rJMSF021J18+ CATACTTCTCGGCGTTGCACTCGAAGGATCAAAGCGCACGCTCCCGATTGAAGAAGAAAT
                      ____________________________________________________________
consensus CATACTTCTCGGCGTTGCACTCGAAGGATCAAAGCGCACGCTCCCGATTGAAGAAGAAAT
 
. : . : . : . : . : . :
rJMSF028O12+ GACTCCATCCTCATCCCCATCCCCATCCCCATCCCCCGCAGCGGCTGTAGAGTCGAAGGA
rJMSF042B08+ GACTCCATCCTCATCCCCATCCCCATCCCCATCCCCCGCAGCGGCTGTAGAGTCGAAGGA
rJMSF039J04+ GACTCCATCCTCATCCCCATCCCCATCCCCATCCCCCGCAGCGGCTGTAGAGTCGAAGGA
rJMSF004O21+ CCATCCTCATCCCCATCCCCATCCCCATCCCCCGCAGCGGCTGTAGAGTCGAAGGA
rJMSF021J18+ GACTCCATCCTCATCCCCATCCCCATCCCCATCCCCCGCAGCGGCTGTAGAGTCGAAGGA
                      ____________________________________________________________
consensus GACTCCATCCTCATCCCCATCCCCATCCCCATCCCCCGCAGCGGCTGTAGAGTCGAAGGA
 
. : . : . : . : . : . :
rJMSF028O12+ GTTGGCCGCCTGCCGGAATGGGAACAACGCCATCACCACCGCCACCACCACTGGCGGCAA
rJMSF042B08+ GTTGGCCGCCTGCCGGAATGGGAACAACGCCATCACCACCGCCACCACCACTGGCGGCAA
rJMSF039J04+ GTTGGCCGCCTGCCGGAATGGGAACAACGCCATCACCACCGCCACCACCACTGGCGGCAA
rJMSF004O21+ GTTGGCCGCCTGCCGGAATGGGAACAACGCCATCACCACCGCCACCACCACTGGCGGCAA
rJMSF021J18+ GTTGGCCGCCTGCCGGAATGGGAACAACGCCATCACCACCGCCACCACCACTGGCGGCAA
                      ____________________________________________________________
consensus GTTGGCCGCCTGCCGGAATGGGAACAACGCCATCACCACCGCCACCACCACTGGCGGCAA
 
. : . : . : . : . : . :
rJMSF028O12+ AGATAAGAAGGATGACGCCGGAGTTCAAAGCTCCTCCCCAAGCGATTTGAAAGAATGATA
rJMSF042B08+ AGATAAGAAGGATGACGCCGGAGTTCAAAGCTCCTCCCCAAGCGATTTGAAAGAATGATA
rJMSF039J04+ AGATAAGAAGGATGACGCCGGAGTTCAAAGCTCCTCCCCAAGCGATTTGAAAGAATGATA
rJMSF004O21+ AGATAAGAAGGATGACGCCGGAGTTCAAAGCTCCTCCCCAAGCGATTTGAAAGAATGATA
rJMSF021J18+ AGATAAGAAGGATGACGCCGGAGTTCAAAGCTCCTCCCCAAGCGATTTGAAAGAATGATA
                      ____________________________________________________________
consensus AGATAAGAAGGATGACGCCGGAGTTCAAAGCTCCTCCCCAAGCGATTTGAAAGAATGATA
 
. : . : . : . : . : . :
rJMSF028O12+ AAAGGAGTGATTATTGCTATAAATTTGAGTGTGCGCAATAATGCAGTAAGGCCATGTTTT
rJMSF042B08+ AAAGGAGTGATTATTGCTATAAATTTGAGTGTGCGCAATAATGCAGTAAGGCCATGTTTT
rJMSF039J04+ AAAGGAGTGATTATTGCTATAAATTTGAGTGTGCGCAATAATGCAGTAAGGCCATGTTTT
rJMSF004O21+ AAAGGAGTGATTATTGCTATAAATTTGAGTGTGCGCAATAATGCAGTAAGGCCATGTTTT
rJMSF021J18+ AAAGGAGTGATTATTGCTATAAATTTGAGTGTGCGCAATAATGCAGTAAGGCCATGTTTT
                      ____________________________________________________________
consensus AAAGGAGTGATTATTGCTATAAATTTGAGTGTGCGCAATAATGCAGTAAGGCCATGTTTT
 
. : . : . : . : . : . :
rJMSF028O12+ TAGCGCCGGCGGCATTGTGCACACTTGTAGAATCGTA-CATGTTACCAAAGTTTCC
rJMSF042B08+ TAGCGCCGGCGGCATTGTGCACACTTGTAGAATCGTA-CATGTTACCAAAGTTTCC
rJMSF039J04+ TAGCGCCGGCGGCATTGTGCACACTTGTAGAATCGTA-CATGTTACCAAAGTTTCC
rJMSF004O21+ TAGCGCCGGCGGCATTGTGCACACTTGTAGAATCGTACCATGTTACCAAAGTTTCC
rJMSF021J18+ TAGCGCCGGCGGCATTGTGCACACTTGTAGAATCGTA-CATGTTACCAAAGTTTCCACTG
                      ____________________________________________________________
consensus TAGCGCCGGCGGCATTGTGCACACTTGTAGAATCGTA-CATGTTACCAAAGTTTCCACTG
 
. : . : . : . : . : . :
rJMSF021J18+ TTGTACTGTAAAACAAGAATCTGCCACCATTAAAGTATTTAAGTTACTGCCCTATTGTCA
                      ____________________________________________________________
consensus TTGTACTGTAAAACAAGAATCTGCCACCATTAAAGTATTTAAGTTACTGCCCTATTGTCA