Previous Contig 012207:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF021J12Sequence723012207 (2)pir|T47436|T474367e-77protein kinase-like protein - Arabidopsis thaliana>gb:ATT18B22_1554756 Arabidops756012207 (2)pir|T47436|T474366e-84protein kinase-like protein - Arabidopsis thaliana>gb:ATT18B22_1554756 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF021J12- ACTGGGACGCCATCCGCCGCGCCCTCTCTTCCTCCTCCTCC
                      ____________________________________________________________
consensus ACTGGGACGCCATCCGCCGCGCCCTCTCTTCCTCCTCCTCC
 
. : . : . : . : . : . :
JMSF021J12- GCCTCCCCCTCTCTCTCAGTCTCCGACCTCCGCTTCATCCACCGCCTTGGCTCCGGCGAC
                      ____________________________________________________________
consensus GCCTCCCCCTCTCTCTCAGTCTCCGACCTCCGCTTCATCCACCGCCTTGGCTCCGGCGAC
 
. : . : . : . : . : . :
JMSF021J12- ATCGGCGCCGTCTATCTCGCCGAGGTCAAAGCTCCCCCGCCACCAGCCGAGCCGCCGCAG
                      ____________________________________________________________
consensus ATCGGCGCCGTCTATCTCGCCGAGGTCAAAGCTCCCCCGCCACCAGCCGAGCCGCCGCAG
 
. : . : . : . : . : . :
JMSF021J12- CCGCAATCTCCGTCGCCATTACAGCAGCCGGCTCTCTTCGCCGCCAAAGTAATGGACAAA
                      ____________________________________________________________
consensus CCGCAATCTCCGTCGCCATTACAGCAGCCGGCTCTCTTCGCCGCCAAAGTAATGGACAAA
 
. : . : . : . : . : . :
JMSF021J12- AAGGAGCTAGCGAGCCGTAATAAGGAAGGGCGGGCGAGGACAGAACGGGAAATCCTGGAA
                      ____________________________________________________________
consensus AAGGAGCTAGCGAGCCGTAATAAGGAAGGGCGGGCGAGGACAGAACGGGAAATCCTGGAA
 
. : . : . : . : . : . :
JMSF021J12- ATGTTAGACCACCCGTTCCTTCCCACCCTCTACGCCTCCATCGATTCCCCTAAATGGTCG
                      ____________________________________________________________
consensus ATGTTAGACCACCCGTTCCTTCCCACCCTCTACGCCTCCATCGATTCCCCTAAATGGTCG
 
. : . : . : . : . : . :
JMSF021J12- TGCCTCTTAACCGAATTCGCTCCCGGCGGCGACCTCCATGTCCTCCGGCAACGTCAGCCC
                      ____________________________________________________________
consensus TGCCTCTTAACCGAATTCGCTCCCGGCGGCGACCTCCATGTCCTCCGGCAACGTCAGCCC
 
. : . : . : . : . : . :
JMSF021J12- GCCAAACGCTTCCCCGAATCCTCAGTCCGATTTTATGCATCAGAGGTGATTGTTGCTATA
                      ____________________________________________________________
consensus GCCAAACGCTTCCCCGAATCCTCAGTCCGATTTTATGCATCAGAGGTGATTGTTGCTATA
 
. : . : . : . : . : . :
JMSF021J12- GAGTATGTACACATGATGGGGATTGTTTATCGTGACCTAAAGCCAGAAAATGTGTTGGTT
                      ____________________________________________________________
consensus GAGTATGTACACATGATGGGGATTGTTTATCGTGACCTAAAGCCAGAAAATGTGTTGGTT
 
. : . : . : . : . : . :
JMSF021J12- AGATCAGACGGCCATATTATGCTGACGGACTTCGACCTTTCCTTAAAATGCGACACGTCT
                      ____________________________________________________________
consensus AGATCAGACGGCCATATTATGCTGACGGACTTCGACCTTTCCTTAAAATGCGACACGTCT
 
. : . : . : . : . : . :
JMSF021J12- ACATCAACTCCGGCGCAAGTAATCTCCGGCCAAAACACGCCCGCCGGCCCGGCGCAAAAC
rJMSF021J12+ TCCGGCCAAAACACGCCCGCCGGCCCGGCGCAAAAC
                      ____________________________________________________________
consensus ACATCAACTCCGGCGCAAGTAATCTCCGGCCAAAACACGCCCGCCGGCCCGGCGCAAAAC
 
. : . : . : . : . : . :
JMSF021J12- CAGTACAGCTACGCCATTGATCCGCCCAAGTTCACCGCATCTTCCTGCATCCTTCCAAAC
rJMSF021J12+ CAGTACAGNTACGCCATTGATCCGCCCAAGTTCACCGCATCTTCCTGCATCCTTCCCAAC
                      ____________________________________________________________
consensus CAGTACAGCTACGCCATTGATCCGCCCAAGTTCACCGCATCTTCCTGCATCCTTCCCAAC
 
. : . : . : . : . : . :
JMSF021J12- TGCATAGTCCCCGCCGTCTCAT
rJMSF021J12+ TGCATAGTCCCCGCCGTCTCATGCTTCCACCCGAACCGGAAGCGCAAGAAGAAGAAGCCC
                      ____________________________________________________________
consensus TGCATAGTCCCCGCCGTCTCATGCTTCCACCCGAACCGGAAGCGCAAGAAGAAGAAGCCC
 
. : . : . : . : . : . :
rJMSF021J12+ GGCCAGCACAGCGGGCCGGAGTTCGTGGCCGAGCCCGTCGACGTCCGGTCAATGTCGTTC
                      ____________________________________________________________
consensus GGCCAGCACAGCGGGCCGGAGTTCGTGGCCGAGCCCGTCGACGTCCGGTCAATGTCGTTC
 
. : . : . : . : . : . :
rJMSF021J12+ GTCGGGACGCACGAGTATCTGGCGCCGGAGATCGTCTCCGGCGAGGGCCACGGCAGCGCC
                      ____________________________________________________________
consensus GTCGGGACGCACGAGTATCTGGCGCCGGAGATCGTCTCCGGCGAGGGCCACGGCAGCGCC
 
. : . : . : . : . : . :
rJMSF021J12+ GTCGATTGGTGGACGCTCGGAATCTTCATCTTCGAGCTGTTATACGGCGTGACGCCGTTC
                      ____________________________________________________________
consensus GTCGATTGGTGGACGCTCGGAATCTTCATCTTCGAGCTGTTATACGGCGTGACGCCGTTC
 
. : . : . : . : . : . :
rJMSF021J12+ AGGGGCGTGGACAACGAGCTAACCCTAGCCAACATCGTCGCCCGCGCCCTGGAATTCCCC
                      ____________________________________________________________
consensus AGGGGCGTGGACAACGAGCTAACCCTAGCCAACATCGTCGCCCGCGCCCTGGAATTCCCC
 
. : . : . : . : . : . :
rJMSF021J12+ AAGGAACCGCCCATCCCCGCCGCCGCCAAGGACTTGATATCACAGCTTCTGGTCAAAGAT
                      ____________________________________________________________
consensus AAGGAACCGCCCATCCCCGCCGCCGCCAAGGACTTGATATCACAGCTTCTGGTCAAAGAT
 
. : . : . : . : . : . :
rJMSF021J12+ CCGGCCCGGCGAATGGGGTCCACCATGGGCGCCACCGCAATAAAGCACCACCCGTTCTTC
                      ____________________________________________________________
consensus CCGGCCCGGCGAATGGGGTCCACCATGGGCGCCACCGCAATAAAGCACCACCCGTTCTTC
 
. : . : . : . : . : . :
rJMSF021J12+ CACGGCGTAAACTGGGCACTTCTACGGTGTACACCGCCCCCCTTCGTGCCGCCGCCTTAT
                      ____________________________________________________________
consensus CACGGCGTAAACTGGGCACTTCTACGGTGTACACCGCCCCCCTTCGTGCCGCCGCCTTAT
 
. : . : . : . : . : . :
rJMSF021J12+ GCTCGTGACGTTTTGTCCGATGAAAGCTGTCCCGACACCCCGGTTGAGTACTATTGAAAA
                      ____________________________________________________________
consensus GCTCGTGACGTTTTGTCCGATGAAAGCTGTCCCGACACCCCGGTTGAGTACTATTGAAAA
 
. : . : . : . : . : . :
rJMSF021J12+ AAAGGATAGCACCCCAATCCCGAATACCACTATTAGTGTGAATATAGATTAATATATGGA
                      ____________________________________________________________
consensus AAAGGATAGCACCCCAATCCCGAATACCACTATTAGTGTGAATATAGATTAATATATGGA
 
. : . : . : . : . : . :
rJMSF021J12+ AACTTTCACACTCTAAATTATATATATATACAGTGATTGACCCTGTTCGGGGTTCCGGTG
                      ____________________________________________________________
consensus AACTTTCACACTCTAAATTATATATATATACAGTGATTGACCCTGTTCGGGGTTCCGGTG