Previous Contig 012203:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003N02Sequence397005995 (6)gb:AC149302_17450038e-11Solanum demissum chromosome 11 clone PGEC400L14 map MAP_LOC, complete sequence.715012203 (6)gb:AC149302_17450037e-71Solanum demissum chromosome 11 clone PGEC400L14 map MAP_LOC, complete sequence.
JMSF005M24Sequence353005995 (6)gb:AC149302_17450035e-16Solanum demissum chromosome 11 clone PGEC400L14 map MAP_LOC, complete sequence.279012203 (6)gb:AC149302_17450030.002Solanum demissum chromosome 11 clone PGEC400L14 map MAP_LOC, complete sequence.
JMSF021I13Sequence653005995 (6)gb:AC149302_17450036e-18Solanum demissum chromosome 11 clone PGEC400L14 map MAP_LOC, complete sequence.758012203 (6)gb:AC149302_17450032e-53Solanum demissum chromosome 11 clone PGEC400L14 map MAP_LOC, complete sequence.
JMSF027H08Sequence687005995 (6)gb:AC149302_17450034e-28Solanum demissum chromosome 11 clone PGEC400L14 map MAP_LOC, complete sequence.724012203 (6)gb:AC149302_17450033e-51Solanum demissum chromosome 11 clone PGEC400L14 map MAP_LOC, complete sequence.
JMSF027P17Sequence646005995 (6)gb:AC149302_17450032e-29Solanum demissum chromosome 11 clone PGEC400L14 map MAP_LOC, complete sequence.765012203 (6)gb:AC149302_17450032e-59Solanum demissum chromosome 11 clone PGEC400L14 map MAP_LOC, complete sequence.
JMSF032J18Sequence670005995 (6)gb:AC149302_17450031e-19Solanum demissum chromosome 11 clone PGEC400L14 map MAP_LOC, complete sequence.718012203 (6)gb:AC149302_17450031e-48Solanum demissum chromosome 11 clone PGEC400L14 map MAP_LOC, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF003N02+ TCTGATGGATAAAGAAACCGAATTGCAAGGAATCT
                      ____________________________________________________________
consensus TCTGATGGATAAAGAAACCGAATTGCAAGGAATCT
 
. : . : . : . : . : . :
rJMSF003N02+ GCGAGGAGAACGAAAACCTAGCTTCGAGATTGGAGAACGGACAATCAGGACGGAGAGAAT
rJMSF027P17+ ACGAAAACCTAGCTTCGAGA-TNGAGAACGGACAATCAGGACGGAGAGAAT
                      ____________________________________________________________
consensus GCGAGGAGAACGAAAACCTAGCTTCGAGATTGGAGAACGGACAATCAGGACGGAGAGAAT
 
. : . : . : . : . : . :
rJMSF003N02+ ACGAACTTGAAAAGGAGCTTCAGAAATCAAAACACGAGATCGAAAACCTGAAGGCGAACT
rJMSF027P17+ ACGAACTTGAAAAGGAGCTTCAGAAATCAAAACACGAGATCGAAAACCTGAAGGCGAACT
rJMSF027H08+ GAAGGCGAACT
rJMSF032J18+ T
rJMSF021I13+ CAGAAATCAAAACNCGAGATCGGAAACCTGAAGGCGAACT
                      ____________________________________________________________
consensus ACGAACTTGAAAAGGAGCTTCAGAAATCAAAACACGAGATCGAAAACCTGAAGGCGAACT
 
. : . : . : . : . : . :
rJMSF003N02+ TAATGGACAAGGAAACAGAGCTGCAGAACATATCAGAGGAAAACGCGATGCTGAAGCTGG
rJMSF027P17+ TAATGGACAAGGAAACAGAGCTGCAGAACATATCAGAGGAAAACGCGATGCTGAAGCTGG
rJMSF027H08+ TAATGGACAAGGAAACAGAGCTGCAGAACATATCAGAGGAAAACGCGATGCTGAAGCTGG
rJMSF032J18+ TAATGGNCAAGGAAACAGAGCTGCAGAACATATCAGAGGAAAACGCGATGCTGAAGCTGG
rJMSF021I13+ TAATGGACAAGGAAACAGAGCTGCAGAACATATCAGAGGAAAACGCGATGCTGAAGCTGG
                      ____________________________________________________________
consensus TAATGGACAAGGAAACAGAGCTGCAGAACATATCAGAGGAAAACGCGATGCTGAAGCTGG
 
. : . : . : . : . : . :
rJMSF003N02+ ACGTCAAGACGAGAGAATCCAACATCGGGGAAACGAATGGCGATACTGCTACTGAACTCG
rJMSF027P17+ ACGTCAAGACGAGAGAATCCAACATCGGGGAAACGAATGGCGATACTGCTACTGAACTCG
rJMSF027H08+ ACGTCAAGACGAGAGAATCCAACATCGGGGAAACGAATGGCGATACTGCTACTGAACTCG
rJMSF032J18+ ACGTCAAGACGAGAGAATCCAACATCGGGGAAACGAATGGCGATACTGCTACTGAACTCG
rJMSF021I13+ ACGTCAAGACGAGAGAATCCAACATCGGGGAAACGAATGGCGATACTGCTACTGAACTCG
                      ____________________________________________________________
consensus ACGTCAAGACGAGAGAATCCAACATCGGGGAAACGAATGGCGATACTGCTACTGAACTCG
 
. : . : . : . : . : . :
rJMSF003N02+ AGGGAGCCAACATGGTAGATCAAGAAGCTCTCGTAAAGCTCAAGTACTTGAAAGAAGAAG
rJMSF027P17+ AGGGAGCCAACATGGTAGATCAAGAAGCTCTCGTAAAGCTCAAGTACTTGAAAGAAGAAG
rJMSF027H08+ AGGGAGCCAACATGGTAGATCAAGAAGCTCTCGTAAAGCTCAAGTACTTGAAAGAAGAAG
rJMSF032J18+ AGGGAGCCAACATGGTAGATCAAGAAGCTCTCGTAAAGCTCAAGTACTTGAAAGAAGAAG
rJMSF021I13+ AGGGAGCCAACATGGTAGATCAAGAAGCTCTCGTAAAGCTCAAGTACTTGAAAGAAGAAG
                      ____________________________________________________________
consensus AGGGAGCCAACATGGTAGATCAAGAAGCTCTCGTAAAGCTCAAGTACTTGAAAGAAGAAG
 
. : . : . : . : . : . :
rJMSF003N02+ CCGATAAGAGCAATCAACGAACGGCTCGAGTGATGGAGCAGCTGGATGCAGCGCAGGCCT
rJMSF027P17+ CCGATAAGAGCAATCAACGAACGGCTCGAGTGATGGAGCAGCTGGATGCAGCGCAGGCCT
rJMSF027H08+ CCGATAAGAGCAATCAACGAACGGCTCGAGTGATGGAGCAGCTGGATGCAGCGCAGGCCT
rJMSF032J18+ CCGATAAGAGCAATCAACGAACGGCTCGAGTGATGGAGCAGCTGGATGCAGCGCAGGCCT
rJMSF021I13+ CCGATAAGAGCAATCAACGAACGGCTCGAGTGATGGAGCAGCTGGATGCAGCGCAGGCCT
                      ____________________________________________________________
consensus CCGATAAGAGCAATCAACGAACGGCTCGAGTGATGGAGCAGCTGGATGCAGCGCAGGCCT
 
. : . : . : . : . : . :
rJMSF003N02+ CCAACGCAGAAATGGAAGCCGAGCTAAGGAGGCTAAAGGTGCAGTGTGACCAATGGCGCA
rJMSF027P17+ CCAACGCAGAAATGGAAGCCGAGCTAAGGAGGCTAAAGGTGCAGTGTGACCAATGGCGCA
rJMSF027H08+ CCAACGCAGAAATGGAAGCCGAGCTAAGGAGGCTAAAGGTGCAGTGTGACCAATGGCGCA
rJMSF032J18+ CCAACGCAGAAATGGAAGCCGAGCTAAGGAGGCTAAAGGTGCAGTGTGACCAATGGCGCA
rJMSF021I13+ CCAACGCAGAAATGGAAGCCGAGCTAAGGAGGCTAAAGGTGCAGTGTGACCAATGGCGCA
                      ____________________________________________________________
consensus CCAACGCAGAAATGGAAGCCGAGCTAAGGAGGCTAAAGGTGCAGTGTGACCAATGGCGCA
 
. : . : . : . : . : . :
rJMSF003N02+ AGGCTGCAGAAGCAGCTGCTGCGATGCTTTCAGCTGGGGACAACGGGAAATTCATCGAGA
rJMSF027P17+ AGGCTGCAGAAGCAGCTGCTGCGATGCTTTCAGCTGGGGACAACGGGAAATTCATCGAGA
rJMSF027H08+ AGGCTGCAGAAGCAGCTGCTGCGATGCTTTCAGCTGGGGACAACGGGAAATTCATCGAGA
rJMSF032J18+ AGGCTGCAGAAGCAGCTGCTGCGATGCTTTCAGCTGGGGACAACGGGAAATTCATCGAGA
rJMSF005M24+ ATCGAGA
rJMSF021I13+ AGGCTGCAGAAGCAGCTGCTGCGATGCTTTCAGCTGGGGACAACGGGAAATTCATCGAGA
                      ____________________________________________________________
consensus AGGCTGCAGAAGCAGCTGCTGCGATGCTTTCAGCTGGGGACAACGGGAAATTCATCGAGA
 
. : . : . : . : . : . :
rJMSF003N02+ AAACATTGCACAACCACAGCCCCGGTTCAGGGAAGATCAGTCCTCCTTACAACGAAGACG
rJMSF027P17+ AAACATTGCACAACCACAGCCCCGGTTCAGGGAAGATCAGTCCTCCTTACAACGAAGACG
rJMSF027H08+ AAACATTGCACAACCACAGCCCCGGTTCAGGGAAGATCAGTCCTCCTTACAACGAAGACG
rJMSF032J18+ AAACATTGCACAACCACAGCCCCGGTTCAGGGAAGATCAGTCCTCCTTACAACGAAGACG
rJMSF005M24+ AAACATTGCACANCCACAGCCCCGGTTCAGGGAAGATCAGTCCTCNTTNCAACGAAGACG
rJMSF021I13+ AAACATTGCACAACCACAGCCCCGGTTCAGGGAAGATCAGTCCTCCTTACAACGAAGACG
                      ____________________________________________________________
consensus AAACATTGCACAACCACAGCCCCGGTTCAGGGAAGATCAGTCCTCCTTACAACGAAGACG
 
. : . : . : . : . : . :
rJMSF003N02+ TGGACGAAGATTTGCTGAAGAGGAAAAACGCAAATATGCTTAAGAGACTCGGCATCTCTT
rJMSF027P17+ TGGACGAAGATTTGCTGAAGAGGAAAAACGCAAATATGCTTAAGAGACTCGGCATCTCTT
rJMSF027H08+ TGGACGAAGATTTGCTGAAGAGGAAAAACGCAAATATGCTTAAGAGACTCGGCATCTCTT
rJMSF032J18+ TGGACGAAGATTTGCTGAAGAGGAAAAACGCAAATATGCTTAAGAGACTCGGCATCTCTT
rJMSF005M24+ TGGNCGAATATTTGCTGAAGAGGAAAAACGCAAATATGCTTAAGAGACTCGGCATCTCTT
rJMSF021I13+ TGGACGAAGATTTGCTGAAGAGGAAAAACGCAAATATGCTTAAGAGACTCGGCATCTCTT
                      ____________________________________________________________
consensus TGGACGAAGATTTGCTGAAGAGGAAAAACGCAAATATGCTTAAGAGACTCGGCATCTCTT
 
. : . : . : . : . : . :
rJMSF003N02+ GGAAGAAGCAACAGAAATAGGAGCTCCTTGCTTAAGAGACTCACATATTTGACATA-TTT
rJMSF027P17+ GGAAGAAGCAACAGAAATAGGAGCTCCTTGCTTAAGAGACTCACATATTTGACATA-TTT
rJMSF027H08+ GGAAGAAGCAACAGAAATAGGAGCTCCTTGCTTAAGAGACTCACATATTTGACATA-TTT
rJMSF032J18+ GGAAGAAGCAACAGAAATAGGAGCTCCTTGCTTAAGAGACTCACATATTTGACATA-TTT
rJMSF005M24+ GGAAGAAGCAACAGAAATAGGAGCTCCTTGCNTAAGAGACTCACATATTTGACATACTTT
rJMSF021I13+ GGAAGAAGCAACAGAAATAGGAGCTCCTTGCTTAAGAGACTCACATATTTGACATA-TTT
                      ____________________________________________________________
consensus GGAAGAAGCAACAGAAATAGGAGCTCCTTGCTTAAGAGACTCACATATTTGACATA-TTT
 
. : . : . : . : . : . :
rJMSF003N02+ AATGTAAGTGGTGTTCTATCT
rJMSF027P17+ AATGTAAGTGGTGTTCTATCTTGTTCCAATGTGTACTTTTCAAACCAATCCATATGGATA
rJMSF027H08+ AATGTAAGTGGTGTTCTATCTTGTTCCAATGTGTACTTTTCAAACCAATCCATATGGATA
rJMSF032J18+ AATGTAAGTGGTGTTCTATCTTGTTCCAATGTGTACTTTTCAAACCAATCCATATGGATA
rJMSF005M24+ AATGTAAGTGGTGTTCTATCTTGTTCCAATGNGTACTTTTCAAACCAATCCATATGGATA
rJMSF021I13+ AATGTAAGTGGTGTTCTATCTTGTTCCAATGTGTACTTTTCAAACCAATCCATATGGATA
                      ____________________________________________________________
consensus AATGTAAGTGGTGTTCTATCTTGTTCCAATGTGTACTTTTCAAACCAATCCATATGGATA
 
. : . : . : . : . : . :
rJMSF027P17+ CTTATTGTGACCAGGTATTATGTTGATGTCTAGGTGATTTTACCATTTGTTGTGGG
rJMSF027H08+ CTTATTGTGACCAGGTATTATGTTGATGTCTAGGTGATTTTA-CATTTGTTGTGGGGTTC
rJMSF032J18+ CTTATTGTGACCAGGTATTATGTTGATGTCTAGGTGATTTTA-CATTTGTTGTGGGGTTC
rJMSF005M24+ CTTANTGTGACCAGGTATTATGTTGATGTCTA
rJMSF021I13+ CTTATTGTGACCAGGTATTATGTTGATGTCTAGGTGATTTTA-CATTTGTTGTGGGGTTC
                      ____________________________________________________________
consensus CTTATTGTGACCAGGTATTATGTTGATGTCTAGGTGATTTTA-CATTTGTTGTGGGGTTC
 
. : . : . : . : . : . :
rJMSF027H08+ TTATTCTGTATTCATGCAAAATATCAGTTGAAACTTGAAACACTAGACTACTTGG
rJMSF032J18+ TTATTCTGTATTCATGCAAAATATCAGTTGAAACTTGAAACACTAGACTACTTGG
rJMSF021I13+ TTATTCTGTATTCATGCAAAATATCAGTTGAAACTTGAAACACTAGACTACTTGGGTAGC
                      ____________________________________________________________
consensus TTATTCTGTATTCATGCAAAATATCAGTTGAAACTTGAAACACTAGACTACTTGGGTAGC