Previous Contig 012201:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF021I02Sequence685012201 (2)gb:BT010723_16406699e-25Arabidopsis thaliana At1g64690 mRNA, complete cds.>gb:BT010991_1640937 Arabidops742012201 (2)pir|A96670|A966702e-23hypothetical protein F13O11.1 [imported] - Arabidopsis thaliana>gb:AE005173_8941

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF021I02- GGACGCCGCAAGAGGGGCTGATGACCACCACGACGATGAT
                      ____________________________________________________________
consensus GGACGCCGCAAGAGGGGCTGATGACCACCACGACGATGAT
 
. : . : . : . : . : . :
JMSF021I02- CAGACCCCAAGAACCAGAACCCATCTCCATTTCTGCTCATCATCGTCCCACCTGGAAACT
                      ____________________________________________________________
consensus CAGACCCCAAGAACCAGAACCCATCTCCATTTCTGCTCATCATCGTCCCACCTGGAAACT
 
. : . : . : . : . : . :
JMSF021I02- GTACGAGAATCCCTTTTATACCAATCCCCACAACCTCAACAACAACAACAATAATCATAG
                      ____________________________________________________________
consensus GTACGAGAATCCCTTTTATACCAATCCCCACAACCTCAACAACAACAACAATAATCATAG
 
. : . : . : . : . : . :
JMSF021I02- TGCCCCTGTCATCAAACGCCACGAAAACAACCAAGTTCTTCACCGCCTGCATCTCCCCGT
                      ____________________________________________________________
consensus TGCCCCTGTCATCAAACGCCACGAAAACAACCAAGTTCTTCACCGCCTGCATCTCCCCGT
 
. : . : . : . : . : . :
JMSF021I02- CTCCGCGCGCAAAATCGCCGCATCTTTCTGGGATTTAACGTTCGTGAAGTCTTCCTACAT
                      ____________________________________________________________
consensus CTCCGCGCGCAAAATCGCCGCATCTTTCTGGGATTTAACGTTCGTGAAGTCTTCCTACAT
 
. : . : . : . : . : . :
JMSF021I02- GGTATCGGAGCTGGAGGCGGCGCGTGCCCAGATCCTGGAGCTGAAGGCCGAGCTGGAATT
rJMSF021I02+ GGCCGAGCTGGAATT
                      ____________________________________________________________
consensus GGTATCGGAGCTGGAGGCGGCGCGTGCCCAGATCCTGGAGCTGAAGGCCGAGCTGGAATT
 
. : . : . : . : . : . :
JMSF021I02- CGAGCGCAAGAGCCGCAAGAAAGTGGAGTCCATGAACAAGAAGCTGGCCCGGGAGCTCTC
rJMSF021I02+ CGAGCGCAAGAGCCGCAAGAAAGTGGAGTCCATGAACAAGAAGCTGGCCCGGGAGCTCTC
                      ____________________________________________________________
consensus CGAGCGCAAGAGCCGCAAGAAAGTGGAGTCCATGAACAAGAAGCTGGCCCGGGAGCTCTC
 
. : . : . : . : . : . :
JMSF021I02- CGAGGAGAGGAAACACAAGGACGCAATGCGGAAAATGTTCGACCGCCTCGCCGCCGAGGC
rJMSF021I02+ CGAGGAGAGGAAACACAAGGACGCAATGCGGAAAATGTTCGACCGCCTCGCCGCCGAGGC
                      ____________________________________________________________
consensus CGAGGAGAGGAAACACAAGGACGCAATGCGGAAAATGTTCGACCGCCTCGCCGCCGAGGC
 
. : . : . : . : . : . :
JMSF021I02- CTCGTCGGAAAAAGCCCAGATCAAGCGGGTGAAGAAGGAGATGGAGGAAGAGCGGAAGAT
rJMSF021I02+ CTCGTCGGAAAAAGCCCAGATCAAGCGGGTGAAGAAGGAGATGGAGGAAGAGCGGAAGAT
                      ____________________________________________________________
consensus CTCGTCGGAAAAAGCCCAGATCAAGCGGGTGAAGAAGGAGATGGAGGAAGAGCGGAAGAT
 
. : . : . : . : . : . :
JMSF021I02- GCTTCGCGTGGCGGAGGTTTTAAGGGAAGAAAGAGTTCAAATGAAGCTCTCCGAGGCCAA
rJMSF021I02+ GCTTCGCGTGGCGGAGGTTTTAAGGGAAGAAAGAGTTCAAATGAAGCTCTCCGAGGCCAA
                      ____________________________________________________________
consensus GCTTCGCGTGGCGGAGGTTTTAAGGGAAGAAAGAGTTCAAATGAAGCTCTCCGAGGCCAA
 
. : . : . : . : . : . :
JMSF021I02- GTTTTTGTTCGAGGAAAAAATGATGGAACTGGAGAAATCAACCGAGAATCTCCACCTCGA
rJMSF021I02+ GTTTTTGTTCGAGGAAAAAATGATGGAACTGGAGAAATCAACCGAGAATCTCCACCTCGA
                      ____________________________________________________________
consensus GTTTTTGTTCGAGGAAAAAATGATGGAACTGGAGAAATCAACCGAGAATCTCCACCTCGA
 
. : . : . : . : . : . :
JMSF021I02- AAAACCAAANTCTCCAGACAACGTTATTCCGACAACCACTGTTTC
rJMSF021I02+ AAAACCAAAATCTCCAGACAACGTTATTCCGACAACCACTGTTTCTTGTTCTTCTAACCA
                      ____________________________________________________________
consensus AAAACCAAAATCTCCAGACAACGTTATTCCGACAACCACTGTTTCTTGTTCTTCTAACCA
 
. : . : . : . : . : . :
rJMSF021I02+ AAGCAGAGCAGTGGCGACCAATAATCCAAGAAAAGCTTCTCCGGAGGCAGAAAACCCACA
                      ____________________________________________________________
consensus AAGCAGAGCAGTGGCGACCAATAATCCAAGAAAAGCTTCTCCGGAGGCAGAAAACCCACA
 
. : . : . : . : . : . :
rJMSF021I02+ CATCAAAAGAGGGATCAAAGGATTCGTGGAGTTTCCGAAAGTGGTTAAAGCAATCGGATC
                      ____________________________________________________________
consensus CATCAAAAGAGGGATCAAAGGATTCGTGGAGTTTCCGAAAGTGGTTAAAGCAATCGGATC
 
. : . : . : . : . : . :
rJMSF021I02+ AAAAAGCAGGCAGTTGAGCACAAAGTTGGAGTGTCAGAAAGCACAGTTAAGGTTGCTTCT
                      ____________________________________________________________
consensus AAAAAGCAGGCAGTTGAGCACAAAGTTGGAGTGTCAGAAAGCACAGTTAAGGTTGCTTCT
 
. : . : . : . : . : . :
rJMSF021I02+ CAAACAGAAGAATCCTGTTCGATCCAACATTGGCCTTCTCACAAGCTAATTAATTATAAG
                      ____________________________________________________________
consensus CAAACAGAAGAATCCTGTTCGATCCAACATTGGCCTTCTCACAAGCTAATTAATTATAAG
 
. : . : . : . : . : . :
rJMSF021I02+ TTTGCAGGTTTTAGTTTTTGCACTTTTTGATCGGTTGATGTTTTGCTGTTTGAATGAAGT
                      ____________________________________________________________
consensus TTTGCAGGTTTTAGTTTTTGCACTTTTTGATCGGTTGATGTTTTGCTGTTTGAATGAAGT
 
. : . : . : . : . : . :
rJMSF021I02+ TTTACAGTGTTTTCTTAGGGAATCATCATACCAGTGTTTGCCTTAGTATACATATTTTTT
                      ____________________________________________________________
consensus TTTACAGTGTTTTCTTAGGGAATCATCATACCAGTGTTTGCCTTAGTATACATATTTTTT