Previous Contig 012200:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF021H19Sequence642012200 (2)gb:AC117988_17394238e-17Oryza sativa chromosome 3 BAC OSJNBa0057G07 genomic sequence, complete sequence.760012200 (2)gb:AC117988_17394233e-11Oryza sativa chromosome 3 BAC OSJNBa0057G07 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF021H19- GGTAATAGCTAG
                      ____________________________________________________________
consensus GGTAATAGCTAG
 
. : . : . : . : . : . :
JMSF021H19- CTAGCGACTAGTAAAGGAAAGGCTAAAAGTTGGAACCTTTCCAAGCTAACAACAATGGCA
                      ____________________________________________________________
consensus CTAGCGACTAGTAAAGGAAAGGCTAAAAGTTGGAACCTTTCCAAGCTAACAACAATGGCA
 
. : . : . : . : . : . :
JMSF021H19- GCCACTGGAAGACTGCTAAGAACATCAAGGCCGTGTGTGGGTATTGGAAATTCTCAATCT
                      ____________________________________________________________
consensus GCCACTGGAAGACTGCTAAGAACATCAAGGCCGTGTGTGGGTATTGGAAATTCTCAATCT
 
. : . : . : . : . : . :
JMSF021H19- TGTTATTCTTTCTATGGTCCAAAAGGCTCTTCTGCTAGATTTGTAAGCAAAGGTGGGTTT
                      ____________________________________________________________
consensus TGTTATTCTTTCTATGGTCCAAAAGGCTCTTCTGCTAGATTTGTAAGCAAAGGTGGGTTT
 
. : . : . : . : . : . :
JMSF021H19- GGAGGGGAGAAGGGGATTGGAGATGGTGAAAAACAACCTAAATCAGCAACCAAGGTGGTC
                      ____________________________________________________________
consensus GGAGGGGAGAAGGGGATTGGAGATGGTGAAAAACAACCTAAATCAGCAACCAAGGTGGTC
 
. : . : . : . : . : . :
JMSF021H19- GCAGCTGCAGCAACCTCAGCAAGTTGTTTAGTCACTACTCCAGAGCCCAAGACAGAGAAA
                      ____________________________________________________________
consensus GCAGCTGCAGCAACCTCAGCAAGTTGTTTAGTCACTACTCCAGAGCCCAAGACAGAGAAA
 
. : . : . : . : . : . :
JMSF021H19- GGGTTGTTGGATTTGGGTTTTTTATTAGGAAAGATCTCAACTTTAATGTTTCAGAGATTG
                      ____________________________________________________________
consensus GGGTTGTTGGATTTGGGTTTTTTATTAGGAAAGATCTCAACTTTAATGTTTCAGAGATTG
 
. : . : . : . : . : . :
JMSF021H19- AGAATGATTACCATCAGACTGCCAAAGAAATTGCATGCCCAGATCTTGATGGAGAAGGCT
                      ____________________________________________________________
consensus AGAATGATTACCATCAGACTGCCAAAGAAATTGCATGCCCAGATCTTGATGGAGAAGGCT
 
. : . : . : . : . : . :
JMSF021H19- ATAGTAGACTGCCGATTCTTTACTTGGTTTGCAGTTGCAGGGTCTCTGCTAGGTTCAGTT
                      ____________________________________________________________
consensus ATAGTAGACTGCCGATTCTTTACTTGGTTTGCAGTTGCAGGGTCTCTGCTAGGTTCAGTT
 
. : . : . : . : . : . :
JMSF021H19- CTGTGCTTTTTTGAGGGTTGTTACATAATCGTGGAATCATATTTCCAGTATTTTCATGCA
rJMSF021H19+ TTACATAATCGTGGAATCATATTTCCAGTATTTTCATGCA
                      ____________________________________________________________
consensus CTGTGCTTTTTTGAGGGTTGTTACATAATCGTGGAATCATATTTCCAGTATTTTCATGCA
 
. : . : . : . : . : . :
JMSF021H19- GTCTCACAACATTCAAACCAAGCCCATCTTGTGCCCCTGTTAATAGAAGCCATTGACATG
rJMSF021H19+ GTCTCACAACATTCAAACCAAGCCCATCTTGTGCCCCTGTTAATAGAAGCCATTGACATG
                      ____________________________________________________________
consensus GTCTCACAACATTCAAACCAAGCCCATCTTGTGCCCCTGTTAATAGAAGCCATTGACATG
 
. : . : . : . : . : . :
JMSF021H19- TTTTTGGTAGGAACAGCTATGCTTACATTC
rJMSF021H19+ TTTTTGGTAGGAACAGCTATGCTTACATTCGGGATAGGACTGCATGTCATGTTTGTTGGA
                      ____________________________________________________________
consensus TTTTTGGTAGGAACAGCTATGCTTACATTCGGGATAGGACTGCATGTCATGTTTGTTGGA
 
. : . : . : . : . : . :
rJMSF021H19+ TCAAACAATTCTAAAGACCAAATGCCACATCTTCCAGGCTCACACTTGCTTCCTGCTCTC
                      ____________________________________________________________
consensus TCAAACAATTCTAAAGACCAAATGCCACATCTTCCAGGCTCACACTTGCTTCCTGCTCTC
 
. : . : . : . : . : . :
rJMSF021H19+ AAGGTAAGAATATTTCATTATTGAGACAACCCAACCAAGTTGATCAGGTTGTTGGCTTGA
                      ____________________________________________________________
consensus AAGGTAAGAATATTTCATTATTGAGACAACCCAACCAAGTTGATCAGGTTGTTGGCTTGA
 
. : . : . : . : . : . :
rJMSF021H19+ TAATCACTAGGTTCCAAGTTCGACGCCGATTGAGAATGGCCTATTATTGGCCTTCTTGGC
                      ____________________________________________________________
consensus TAATCACTAGGTTCCAAGTTCGACGCCGATTGAGAATGGCCTATTATTGGCCTTCTTGGC
 
. : . : . : . : . : . :
rJMSF021H19+ TTGAGCTGTTTATGGACAACCTAAGTTGGTTTACCCCGAAAATGATGTTATGGTGATTAT
                      ____________________________________________________________
consensus TTGAGCTGTTTATGGACAACCTAAGTTGGTTTACCCCGAAAATGATGTTATGGTGATTAT
 
. : . : . : . : . : . :
rJMSF021H19+ TTTTGCGTCTCTTATAGAGTCTCCCGGAGAAGGTTGGAATGCGGTCAGTTATGCAGGCAA
                      ____________________________________________________________
consensus TTTTGCGTCTCTTATAGAGTCTCCCGGAGAAGGTTGGAATGCGGTCAGTTATGCAGGCAA
 
. : . : . : . : . : . :
rJMSF021H19+ AGTCGAAAATCGGGCATGCTGTGATAATGATACTCCAGGTTGGGGTGCTGGAGAAGTTCA
                      ____________________________________________________________
consensus AGTCGAAAATCGGGCATGCTGTGATAATGATACTCCAGGTTGGGGTGCTGGAGAAGTTCA
 
. : . : . : . : . : . :
rJMSF021H19+ AAGAAATACCTTTGGTTAGCAGCTTGGATCTTGCTTGTTTCGCCGCAGTTGTGTTTGTTT
                      ____________________________________________________________
consensus AAGAAATACCTTTGGTTAGCAGCTTGGATCTTGCTTGTTTCGCCGCAGTTGTGTTTGTTT
 
. : . : . : . : . : . :
rJMSF021H19+ CGTCGGCCAGTGTCTTCCTTCTTTCCAAACTTAGCACCGGAACCGCAGCAGCCGATACAT
                      ____________________________________________________________
consensus CGTCGGCCAGTGTCTTCCTTCTTTCCAAACTTAGCACCGGAACCGCAGCAGCCGATACAT
 
. : . : . : . : . : . :
rJMSF021H19+ AGACAAGAAAAAATGCTAATTATGTATGTGGCTGTCGGAGTGTCGGGAAGCCAAAAGCAC
                      ____________________________________________________________
consensus AGACAAGAAAAAATGCTAATTATGTATGTGGCTGTCGGAGTGTCGGGAAGCCAAAAGCAC
 
. : . : . : . : . : . :
rJMSF021H19+ TATAGAATAATGGATGTAAATGAGAATAGGAATCATTTATTTTGTTTATTATTCAACATT
                      ____________________________________________________________
consensus TATAGAATAATGGATGTAAATGAGAATAGGAATCATTTATTTTGTTTATTATTCAACATT