Previous Contig 012197:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003L09Sequence585000019 (14)gb:AB016061_15127541e-63Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.796012197 (11)gb:AB016061_15127543e-94Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.
JMFF004B01Sequence195000019 (14)813012197 (11)gb:AB016061_15127548e-96Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.
JMFF017C13Sequence550000019 (14)gb:AB016061_15127544e-50Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.753012197 (11)gb:AB016061_15127547e-82Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.
JMFF024F23Sequence551000019 (14)gb:AB016061_15127542e-31Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.728012197 (11)gb:AB016061_15127541e-81Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.
JMFF025P22Sequence555000019 (14)gb:AB016061_15127542e-32Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.772012197 (11)gb:AB016061_15127542e-86Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.
JMFF027E05Sequence553000019 (14)gb:AB016061_15127546e-32Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.696012197 (11)gb:AB016061_15127541e-81Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.
JMFF029A20Sequence549000019 (14)gb:AB016061_15127545e-50Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.750012197 (11)gb:AB016061_15127547e-94Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.
JMFF038E03Sequence392000019 (14)gb:AB016061_15127547e-34Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.685012197 (11)gb:AB016061_15127549e-71Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.
JMFN040J16Sequence607012197 (11)gb:AB016061_15127547e-52Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.
JMSF021G20Sequence654000019 (14)gb:AB016061_15127541e-66Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.735012197 (11)gb:AB016061_15127549e-72Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.
JMSF023K22Sequence612000019 (14)gb:AB016061_15127543e-60Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.769012197 (11)gb:AB016061_15127549e-83Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF003L09+ GAGGAAAGATTTCTN
                      ____________________________________________________________
consensus GAGGAAAGATTTCTN
 
. : . : . : . : . : . :
rJMFF003L09+ GGATGTATTGCTCGAGTTTGAAGGGCAATAGAAAAGATGACCCAGCCAAGCTATCAGAAC
rJMFF029A20+ ATGGAAAGGATGAACCAGCCAAGCTATCAGAAC
rJMFF017C13+ ATGGAAAGGATGANCCAGCCAAGCTATCAGAAC
rJMFF004B01+ TCGAGTTTGAA-GGCAATGGAAAGGATGANCCAGCCAAGCTATCAGAAC
rJMFF025P22+ AGAAC
                      ____________________________________________________________
consensus GGATGTATTGCTCGAGTTTGAAGGGCAATGGAAAGGATGACCCAGCCAAGCTATCAGAAC
 
. : . : . : . : . : . :
rJMFF003L09+ ATGAAAT-CAATATATTTGTAACGGAAATGTTTTTCGCTGGTACAGAGACGACTAGCAGC
rJMFF029A20+ ATGAAAT-CAATATATTTGTAATGGAAATGTTTTTCGCTGGTACAGAGACGAGTAGCAGC
rJMFF017C13+ ATGAAATCCAATATATTTGTAATGGAAATGTTTTTCGCTGGTACAGAGACGAGTAGCAGC
rJMFF027E05+ TGGTACAGAGACGAGTAGCAGC
rJMSF023K22+ GGAAATGTTTTTCGGTGGTACAGAGACGACTAGCAGC
rJMFF004B01+ ATGAAAT-CAATATATTTGTAATGGAAATGTTTTTCGCTGGTACAGAGACGAGTAGCAGC
rJMFF025P22+ ATGAAATCCAATATATTTGTAATGGAAATGTTTTTCGCTGGTACAGAGACGAGTAGCAGC
rJMFF024F23+ GGTACAGAGACGAGTAGCAGC
                      ____________________________________________________________
consensus ATGAAAT-CAATATATTTGTAATGGAAATGTTTTTCGCTGGTACAGAGACGAGTAGCAGC
 
. : . : . : . : . : . :
rJMFF003L09+ AGTGTGGAATGGGCACTAAGTGAGCTCTTGTGTAACCCAAAAGCGATGGCCAAAGTCAAA
rJMFF029A20+ ATAGTGGAATGGGCACTAACTGAGCTCTTGTGTAACCCAACAGTGATGGCCAAAGTCAAA
rJMFF017C13+ ATAGTGGAATGGGCACTAACTGAGCTCTTGTGTAACCCAACAGTGATGGCCAAAGTCAAA
rJMFF027E05+ ATTGTGGAATGGGCACTAACTGAGCTCTTGTGTAACCCAACAGTGATGGCCAAAGTCAAA
rJMFF038E03+ ACAGTGATGNCCAAAGTCAAA
rJMSF023K22+ AGTGTGGAATGGGCACTAAGTGAGCTCTTGTGTAACCCAAAAGCGATGGCCAAAGTCAAA
rJMFF004B01+ ATTGTGGAATGGGCACTAACTGAGCTCTTGTGTAACCCAACAGTGATGGCCAAAGTCAAA
rJMFF025P22+ ATTGTGGAATGGGCACTAACTGAGCTCTTGTGTAACCCAACAGTGATGGCCAAAGTCAAA
rJMFF024F23+ ATTGTGGAATGGGCACTAACTGAGCTCTTGTGTAACCCAACAGTGATGGCCAAAGTCAAA
rJMSF021G20+ CAAAAGCGATGGCCAAAGTCAAA
                      ____________________________________________________________
consensus ATTGTGGAATGGGCACTAACTGAGCTCTTGTGTAACCCAACAGTGATGGCCAAAGTCAAA
 
. : . : . : . : . : . :
rJMFF003L09+ GAAGAGATTTATGAAGTTGTAGGACCAAACCGGAGATTTG-AGGAAAGTGATATTGATAA
rJMFF029A20+ GACGAGATTTATGAAGTTGTAGGACCAAACCGGAGATTTG-AGGAAAGTGATATTGATAA
rJMFF017C13+ GACGAGATTTATGAAGTTGTAGGACCAAACCGGAGATTTGCAGGAAAGTGATATTGATAA
rJMFF027E05+ GACGAGATTTATGAAGTTGTAGGACCAAACCGGAGATTTG-AGGAAAGTGATATTGATAA
rJMFF038E03+ GACGAGATTTATGAAGTTGTAGGACCAAACCGGAGATTTG-AGGAAAGTGATATTGATAA
rJMSF023K22+ GAAGAGATTTATGAAGTTGTAGGACCAAACAGGAGATTTG-AGGAAAGTGATATTGATAA
rJMFF004B01+ GACGAGATTTATGAAGTTGTAGGACCAAACCGGAGATTTG-AGGAAAGTGATATTGATAA
rJMFF025P22+ GACGAGATTTATGAAGTTGTAGGACCAAACCGGAGATTTG-AGGAAAGTGATATTGATAA
rJMFF024F23+ GACGAGATTTATGAAGTTGTAGGACCAAACCGGAGATTTG-AGGAAAGTGATATTGATAA
rJMSF021G20+ GAAGAGATTTATGAAGTTGTAGGACCAAACCGGAGATTTG-AGGAAAGTGATATTGATAA
                      ____________________________________________________________
consensus GACGAGATTTATGAAGTTGTAGGACCAAACCGGAGATTTG-AGGAAAGTGATATTGATAA
 
. : . : . : . : . : . :
rJMFF003L09+ TCTGCAGTACATGCAGGCAGTGGTCAAGGAAACACTACGTTTGCATCCCCCTGCTGCTTT
rJMFF029A20+ TCTGCAGTACATGCAGGCAGTGGTCAAGGAAACACTACGTTTGCATCCCCCTGCTCCTCT
rJMFF017C13+ TCTGCAGTACATGCAGGCAGTGGTCAAGGAAACACTACGTTTGCATCCCCCTGCTCCTCT
rJMFF027E05+ TCTGCAGTACATGCAGGCAGTGGTCAAGGAAACACTACGTTTGCATCCCCCTGCTCCTCT
rJMFF038E03+ TCTGCAGTACATGCAGGCAGTGGTCAAGGAAACACTACGTTTGCATCCCCCTGCTCCTCT
rJMSF023K22+ TCTGCAGTACATGCAGGCAGTGGTCAAGGAAACACTACGTTTGCATCCCCCTGGTACTTT
JMFN040J16- TACGTTTGCATCCCCCTGGTACTTT
rJMFF004B01+ TCTGCAGTACATGCAGGCAGTGGTCAAGGAAACACTACGTTTGCATCCCCCTGCTCCTCT
rJMFF025P22+ TCTGCAGTACATGCAGGCAGTGGTCAAGGAAACACTACGTTTGCATCCCCCTGCTCCTCT
rJMFF024F23+ TCTGCAGTACATGCAGGCAGTGGTCAAGGAAACACTACGTTTGCATCCCCCTGCTCCTCT
rJMSF021G20+ TCTGCAGTACATGCAGGCAGTGGTCAAGGAAACACTACGTTTGCATCCCCCTGCTGCTTT
                      ____________________________________________________________
consensus TCTGCAGTACATGCAGGCAGTGGTCAAGGAAACACTACGTTTGCATCCCCCTGCTCCTCT
 
. : . : . : . : . : . :
rJMFF003L09+ CTTAGTGCCAAGAAGAGCAATTCAAGATACTAAATTTATGGAGTATGACATACCTAAAGA
rJMFF029A20+ CTTAGGGCCAAGAAGAGCAATTCAAGATACTAAATTTATGGAGTATGACATACCTAAAGA
rJMFF017C13+ CTTAGGGCCAAGAAGAGCAATTCAAGATACTAAATTTATGGAGTATGACATACCTAAAGA
rJMFF027E05+ CTTAGGGCCAAGAAGAGCAATTCAAGATACTAAATTTATGGAGTATGACATACCTAAAGA
rJMFF038E03+ CTTAGGGCCAAGAAGAGCAATTCAAGATACTAAATTTATGGAGTATGACATACCTAAAGA
rJMSF023K22+ CTTAGTGCCAAGAAGAGCAATTCAAGATACTAAATTTATGGAGTATGACATACCTAAAGA
JMFN040J16- CTTAGTGCCAAGAAGAGCAATTCAAGATATTAAATTTATGGAGTATGACATACCTAAAGA
rJMFF004B01+ CTTAGGGCCAAGAAGAGCAATTCAAGATACTAAATTTATGGAGTATGACATACCTAAAGA
rJMFF025P22+ CTTAGGGCCAAGAAGAGCAATTCAAGATACTAAATTTATGGAGTATGACATACCTAAAGA
rJMFF024F23+ NTTAGGGCCAAGAAGAGCAATTCAAGATACTAAATTTATGGAGTATGACATACCTAAAGA
rJMSF021G20+ CTTAGTGCCAAGAAGAGCAATTCAAGATACTAAATTTATGGAGTATGACATACCTAAAGA
                      ____________________________________________________________
consensus CTTAGGGCCAAGAAGAGCAATTCAAGATACTAAATTTATGGAGTATGACATACCTAAAGA
 
. : . : . : . : . : . :
rJMFF003L09+ CACCCAAGTCTTCGTAAATGTTTGGGCAATTGGACGAGACCCTGAAAGCTGGGATGACCC
rJMFF029A20+ CACTCAAGTCTTCGTAAATGTTTGGGCAATTGGACGAGACCCTGAAAGCTGGAATGACCC
rJMFF017C13+ CACTCAAGTCTTCGTAAATGTTTGGGCAATTGGACGAGACCCTGAAAGCTGGAATGACCC
rJMFF027E05+ CACTCAAGTCTTCGTAAATGTTTGGGCAATTGGACGAGACCCTGAAAGCTGGAATGACCC
rJMFF038E03+ CACTCAAGTCTTCGTAAATGTTTGGGCAATTGGACGAGACCCTGAAAGCTGGAATGACCC
rJMSF023K22+ CACTCAAGTCTTCGTAAATGTTTGGGCAATTGGACGAGACCCTGAAAGCTGGGATGACCC
JMFN040J16- CACTCAAGTCTTCGTAAATGTTTGGGCAATTGGACGAGACCCTGAAAGCTGGGATGACCC
rJMFF004B01+ CACTCAAGTCTTCGTAAATGTTTGGGCAATTGGACGAGACCCTGAAAGCTGGAATGACCC
rJMFF025P22+ CACTCAAGTCTTCGTAAATGTTTGGGCAATTGGACGAGACCCTGAAAGCTGGAATGACCC
rJMFF024F23+ CACTCAAGTCTTCGTAAATGTTTGGGCAATTGGACGAGACCCTGAAAGCTGGAATGACCC
rJMSF021G20+ CACCCAAGTCTTCGTAAATGTTTGGGCAATTGGACGAGACCCTGAAAGCTGGGATGACCC
                      ____________________________________________________________
consensus CACTCAAGTCTTCGTAAATGTTTGGGCAATTGGACGAGACCCTGAAAGCTGGAATGACCC
 
. : . : . : . : . : . :
rJMFF003L09+ TCTATCTTTCAAGCCTGAGAGGTTCCTGGGCTCAAATATAGACTTCAAGGGGCAGGATTT
rJMFF029A20+ TCTAACTTTCAAACCTGAGAGATTTCTGGGCTCAAATATAGACTTCAAGGGGCAGGATTT
rJMFF017C13+ TCTAACTTTCAAACCTGAGACATTTCTGGGCTCAAATATAGACTTCAAGGGGCAGGATTT
rJMFF027E05+ TCTAACTTTCAAACCTGAGAGATTTCTGGGCTCAAATATAGACTTCAAGGGGCAGGATTT
rJMFF038E03+ TCTAACTTTCAAACCTGAGAGATTTCTGGGCTCAAATATAGACTTCAAGGGGCAGGATTT
rJMSF023K22+ TCTATCTTTCAAGCCTGAGAGATTTCTGGGCTCAAATATAGACTTCAAGGGGCAGGATTT
JMFN040J16- TCTATCTTTCAAGCCTGAGAGATTTCTGGGCTCAAATATAGACTTCAAGGGGCAGGATTT
rJMFF004B01+ TCTAACTTTCAAACCTGAGAGATTTCTGGGCTCAAATATAGACTTCAAGGGGCAGGATTT
rJMFF025P22+ TCTAACTTTCAAACCTGAGAGATTTCTGGGCTCAAATATAGACTTCAAGGGGCAGGATTT
rJMFF024F23+ TCTAACTTTCAAACCTGAGAGATTTCTGGGCTCAAATATAGACTTCAAGGGGCAGGATTT
rJMSF021G20+ TCTATCTTTCAAGCCTGAGAGGTTCCTGGGCTCAAATATAGACTTCAAGGGGCAGGATTT
                      ____________________________________________________________
consensus TCTAACTTTCAAACCTGAGAGATTTCTGGGCTCAAATATAGACTTCAAGGGGCAGGATTT
 
. : . : . : . : . : . :
rJMFF003L09+ TGAATTTCTACCATTTGGTGCAGGCCGGAGGATTTGTGTAGGCCTCCCGTTAGGTAACCG
rJMFF029A20+ TGAATTTCTACCATTTGGTGCAGGCCGGAGGATCTGTGTAGGCCTCCCGTTAGGTAACCG
rJMFF017C13+ TGAATTTCTACCATTTGGTGCAGGCCGGAGGATCTGTGTAGGCCTCCCGTTAGGTAACCG
rJMFF027E05+ TGAATTTCTACCATTTGGTGCAGGCCGGAGGATCTGTGTAGGCCTCCCGTTAGGTAACCG
rJMFF038E03+ TGAATTTCTACCATTTGGTGCAGGCCGGAGGATCTGTGTAGGCCTCCCGTTAGGTAACCG
rJMSF023K22+ TGAATTTCTACCATTTGGTGCAGGCCGGAGGATCTGTGTAGGCCTCTCGTTAGGTAACCG
JMFN040J16- TGAATTTCTACCATTTGGTGCAGGCCGGAGGATCTGTGTAGGCCTCTCGTTAGGTAACCG
rJMFF004B01+ TGAATTTCTACCATTTGGTGCAGGCCGGAGGATCTGTGTAGGCCTCCCGTTAGGTAACCG
rJMFF025P22+ TGAATTTCTACCATTTGGTGCAGGCCGGAGGATCTGTGTAGGCCTCCCGTTAGGTAACCG
rJMFF024F23+ TGAATTTCTACCATTTGGTGCAGGCCGGAGGATCTGTGTAGGCCTCCCGTTAGGTAACCG
rJMSF021G20+ TGAATTTCTACCATTTGGTGCAGGCCGGAGGATTTGTGTAGGCCTCCCGTTAGGTAACCG
                      ____________________________________________________________
consensus TGAATTTCTACCATTTGGTGCAGGCCGGAGGATCTGTGTAGGCCTCCCGTTAGGTAACCG
 
. : . : . : . : . : . :
rJMFF003L09+ GATGCTGCATTTCATTCTAGGATCGCTGCTCCATGCCTTCGACTGGGAGCTCGAATGCAA
rJMFF029A20+ GATGGTGCATTTCATTCTGGGATCGCTGCTCCATGCCTTCGACTGGGAGCTCGAATGCAA
rJMFF017C13+ GATGGTGCATTTCATTCTGGGATCGCTGCTCCATGCCTTCGACTGGGAGCTCGAATGCAA
rJMFF027E05+ GATGGTGCATTTCATTCTGGGATCGCTGCTCCATGCCTTCGACTGGGAGCTCGAATGCAA
rJMFF038E03+ GATGGTGCATTTCATTCTGGGATCGCTGCTCCATGCCTTCGACTGGGAGCTCGAATGCAG
rJMSF023K22+ GATGATGCATTTCATTCTGGGATCGCTGCTCCATGCCTTCGACTGGGAGCTCGAATGCAA
JMFN040J16- GATGATGCATTTCATTCTGGGATCGCTGCTCCATGCCTTCGACTGGGAGCTCGAATGCAA
rJMFF004B01+ GATGGTGCATTTCATTCTGGGATCGCTGCTCCATGCCTTCGACTGGGAGCTCGAATGCAA
rJMFF025P22+ GATGGTGCATTTCATTCTGGGATCGCTGCTCCATGCCTTCGACTGGGAGCTCGAATGCAA
rJMFF024F23+ GATGGTGCATTTCATTCTGGGATCGCTGCTCCATGCCTTCGACTGGGAGCTCGAATGCAA
rJMSF021G20+ GATGCTGCATTTCATTCTAGGATCGCTGCTCCATGCCTTCGACTGGGAGCTCGAATGCAA
                      ____________________________________________________________
consensus GATGGTGCATTTCATTCTGGGATCGCTGCTCCATGCCTTCGACTGGGAGCTCGAATGCAA
 
. : . : . : . : . : . :
rJMFF003L09+ TGTGACCTCACAATCTCTGGACATGAAAGAAAGGATGGGAGTAGCAGTTAGCAAATCTGA
rJMFF029A20+ TGTGACCTCACAAACTGTGGACATGAAAGAAAGGATGGGAATGGTAGTTAGCAAATCTGA
rJMFF017C13+ TGTGACCTCACAAACTGTGGACATGAAAGAAAGGATGGGAATGGTAGTTAGCAAATCTGA
rJMFF027E05+ TGTGACCTCACAAACTGTGGACATGAAAGAAAGGATGGGAATGGTAGTTAGCAAATCTGA
rJMFF038E03+ TGTGACCTCACAAACTGTGGACATGAAAGAAAGGATGGGAATGGTAGTTAGCAAATCTGA
rJMSF023K22+ TGTGACCTCACAGTCTCTGGACATTAAAGAAAGGATGGGAATAGTAGTTAGCAAATCTGA
JMFN040J16- TGTGACCTCACAGTCTCTGGACATTAAAGAAAGGATGGGAATAGTAGTTAGCAAATCTGA
rJMFF004B01+ TGTGACCTCACAAACTGTGGACATGAAAGAAAGGATGGGAATGGTAGTTAGCAAATCTGA
rJMFF025P22+ TGTGACCTCACAAACTGTGGACATGAAAGAAAGGATGGGAATGGTAGTTAGCAAATCTGA
rJMFF024F23+ TGTGACCTCACAAACTGTGGACATGAAAGAAAGGATGGGAATGGTAGTTAGCAAATCTGA
rJMSF021G20+ TGTGACCTCACAATCTCTGGACATGAAAGAAAGGATGGGAGTAGCAGTTAGCAAATCTGA
                      ____________________________________________________________
consensus TGTGACCTCACAAACTGTGGACATGAAAGAAAGGATGGGAATGGTAGTTAGCAAATCTGA
 
. : . : . : . : . : . :
rJMFF003L09+ GCCCCTGAAAGCAATACCAAGGAGAATTGTAGCTTGAAAGAAGTTACGAGTCTAAATAGT
rJMFF029A20+ ACCCCTGAAAGCAATACCAAGGAGAATTGTAGCTTGAAAGAATTTACAAGTCTAAATAGT
rJMFF017C13+ ACCCCTGAAAGCAATACCAAGGAGAATTGTAGCTTGAAAGAATTTACAAGTCTAAATAGT
rJMFF027E05+ ACCCCTGAAAGCAATACCAAGGAGAATTGTAGCTTGAAAGAATTTACAAGTCTAAATAGT
rJMFF038E03+ ACCCCTGAAAGCAATACCAAGGAGAATTGTAGCTTGAAAGAATTTACAAGTCTAAATAGT
rJMSF023K22+ ACCCCTGAAAGCAATACCAAAGAGAATTGTAGCTTGAAAGAAGTTACAAATCTAAATAGT
JMFN040J16- ACCCCTGAAAGCAATACCAAAGAGAATTGTAGCTTGAAAGAAGTTACAAATCTAAATAGT
rJMFF004B01+ ACCCCTGAAAGCAATACCAAGGAGAATTGTAGCTTGAAAGAATTTACAAGTCTAAATAGT
rJMFF025P22+ ACCCCTGAAAGCAATACCAAGGAGAATTGTAGCTTGAAAGAATTTACAAGTCTAAATAGT
rJMFF024F23+ ACCCCTGAAAGCAATACCAAGGAGAATTGTAGCTTGAAAGAATTTACAAGTCTAAATAGT
rJMSF021G20+ GCCCCTGAAAGCAATACCAAGGAGAATTGTAGCTTGAAAGAAGTTACGAGTCTAAATAGT
                      ____________________________________________________________
consensus ACCCCTGAAAGCAATACCAAGGAGAATTGTAGCTTGAAAGAATTTACAAGTCTAAATAGT
 
. : . : . : . : . : . :
rJMFF003L09+ GCATTTGCATTGAGACCTGTTATGACTTACCATG---TAT-CTGTTTTACTTGCTGAAGA
rJMFF029A20+ GCATTTGCATTCAGACCTGTTATGACTTACCATG---TAT-CTGTTTTACTTGCTGAAGA
rJMFF017C13+ GCATTTGCATTCAGACCTGTTATGACTTACCATG---TAT-CTGTTTTACTTGCTGAAGA
rJMFF027E05+ GCATTTGCATTCAGACCTGTTATGACTTACCATG---TAT-CTGTTTTACTTGCTGAAGA
rJMFF038E03+ GCATTTGCATTCAGACCTGTTATGACTTACCATG---TAT-CTGTTTTACTTGCTGAAGA
rJMSF023K22+ GCATTTGCATTGAGACCTGTTATGACTTAGAATGTTCTATACTGTTTTACTTGCTGAATA
JMFN040J16- GCATTTGCATTGAGACCTGTTATGACTTAGAATGTTCTATACTGTTTTACTTGCTGAATA
rJMFF004B01+ GCATTTGCATTCAGACCTGTTATGACTTACCATG---TAT-CTGTTTTACTTGCTGAAGA
rJMFF025P22+ GCATTTGCATTCAGACCTGTTATGACTTACCATG---TAT-CTGTTTTACTTGCTGAAGA
rJMFF024F23+ GCATTTGCATTCAGACCTGTTATGACTTACCATG---TAT-CTGTTTTACTTGCTGAAGA
rJMSF021G20+ GCATTTGCATTGAGACCTGTTATGACTTACCATG---TAT-CTGTTTTACTTGCTGAAGA
                      ____________________________________________________________
consensus GCATTTGCATTCAGACCTGTTATGACTTACCATG---TAT-CTGTTTTACTTGCTGAAGA
 
. : . : . : . : . : . :
rJMFF003L09+ ATAA
rJMFF029A20+ ATA
rJMFF017C13+ ATA
rJMFF027E05+ ATAATCTCAGTGCACATGT
rJMFF038E03+ ATAATCTCAGTGCACATGTATGTAATA
rJMSF023K22+ ATAATCTCAGTGCACA
JMFN040J16- ATAATCTCAGTGCACA
rJMFF004B01+ ATAATCTCAGTGCACATGTATGTAATATTGATCTGCTTGCAACTATAAGAT
rJMFF025P22+ ATAATCTCAGTGCACATGTATGTAATATTGATCTGCTTGCAACTATAAGATT
rJMFF024F23+ ATAATCTCAGTGCACATGTATGTAATATTGATCTGCTTGCAACTATAAGATT
rJMSF021G20+ ATAAGCTCAGTGCACAGAT---TAGTATGAATATATATATTGATATAAAATCACATCATT
                      ____________________________________________________________
consensus ATAATCTCAGTGCACATGTATGTAATATTGATCTGCTTGCAACTATAAGATTACATCATT
 
. : . : . : . : . : . :
rJMSF021G20+ CCATTGAAAACGCCACTAGTGCAGCAAGCTTTGGCTGCACGAAATCTCATGTAGCTATAT
                      ____________________________________________________________
consensus CCATTGAAAACGCCACTAGTGCAGCAAGCTTTGGCTGCACGAAATCTCATGTAGCTATAT