Previous Contig 012193:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF006F03Sequence389004604 (2)gb:AB005231_15092724e-26Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBB18.>gb:AB049627_1520129012193 (2)
JMSF021G15Sequence666005981 (3)gb:AY072209_15670963e-18Arabidopsis thaliana putative Rab geranylgeranyl transferase (At4g24490) mRNA, c723012193 (2)gb:AY072209_15670968e-38Arabidopsis thaliana putative Rab geranylgeranyl transferase (At4g24490) mRNA, c

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF021G15+ CAG
                      ____________________________________________________________
consensus CAG
 
. : . : . : . : . : . :
rJMSF021G15+ TTTTACAATGATTTAATGGAATTGGATCCACCACACATTCAGTACTATAAGGATGAATAC
                      ____________________________________________________________
consensus TTTTACAATGATTTAATGGAATTGGATCCACCACACATTCAGTACTATAAGGATGAATAC
 
. : . : . : . : . : . :
rJMSF021G15+ AGCTCTGTCTTACTAAGACAGTTATTCTCCAATCAAGAGTCTTTGCTGGAACGCTGCCAT
                      ____________________________________________________________
consensus AGCTCTGTCTTACTAAGACAGTTATTCTCCAATCAAGAGTCTTTGCTGGAACGCTGCCAT
 
. : . : . : . : . : . :
rJMSF021G15+ CAATATCGAGAACCATCTTCTTCAATCATTTATAATTATTCATGTCTGCGGCTAAATAAC
                      ____________________________________________________________
consensus CAATATCGAGAACCATCTTCTTCAATCATTTATAATTATTCATGTCTGCGGCTAAATAAC
 
. : . : . : . : . : . :
rJMSF021G15+ CTCTCACTTTCTCGAGTTGGGTGTGTCGAAAAACTTTTGTGGGTCCAGATCCTAGATCTT
                      ____________________________________________________________
consensus CTCTCACTTTCTCGAGTTGGGTGTGTCGAAAAACTTTTGTGGGTCCAGATCCTAGATCTT
 
. : . : . : . : . : . :
rJMSF021G15+ AGCTGCAACCAACTTCGGTCAATTGAAGGCATGGAGGCAATGCAGCTACTCTCTTGTTTA
                      ____________________________________________________________
consensus AGCTGCAACCAACTTCGGTCAATTGAAGGCATGGAGGCAATGCAGCTACTCTCTTGTTTA
 
. : . : . : . : . : . :
rJMSF021G15+ AACCTAAGCAAGAACTTACTTTGCAGTTTCACTGCTTTGGAGCCTTTAAGGCAGCTAAGA
                      ____________________________________________________________
consensus AACCTAAGCAAGAACTTACTTTGCAGTTTCACTGCTTTGGAGCCTTTAAGGCAGCTAAGA
 
. : . : . : . : . : . :
rJMSF006F03+ CTCAATTGACACAAGA
rJMSF021G15+ TTGCTAAAAGTATTGGACATCTCATCCAATGAGATCGGTGCGCACTCAATTGACACAAGA
                      ____________________________________________________________
consensus TTGCTAAAAGTATTGGACATCTCATCCAATGAGATCGGTGCGCACTCAATTGACACAAGA
 
. : . : . : . : . : . :
rJMSF006F03+ AGGTACCTGTGTTCNTNTCCANTGCGCCACAGTAATGGAAGTGCTTGGAACATCGAGCAN
rJMSF021G15+ AGGTACCTGTGTTCTTCTCCGCTGTGCCACAGTAATGGAAGTGCTTGGAACATCGAGCAA
                      ____________________________________________________________
consensus AGGTACCTGTGTTCTTCTCCGCTGTGCCACAGTAATGGAAGTGCTTGGAACATCGAGCAA
 
. : . : . : . : . : . :
rJMSF006F03+ TTTTCAACNNATGCTGTCAATGCAANTGATTCCTGGGANGCATT
rJMSF021G15+ TTTTCAACCGATGCTGTCAATGCAACTGATTACTGGGAAGCATTCTTAGTCTTTAAAAAT
                      ____________________________________________________________
consensus TTTTCAACCGATGCTGTCAATGCAACTGATTCCTGGGAAGCATTCTTAGTCTTTAAAAAT
 
. : . : . : . : . : . :
rJMSF021G15+ CTGAATTTGATACAACTAGATATTGCGGGAAATGCTGTTTCTGATGAAAAGTTAAAGTTG
                      ____________________________________________________________
consensus CTGAATTTGATACAACTAGATATTGCGGGAAATGCTGTTTCTGATGAAAAGTTAAAGTTG
 
. : . : . : . : . : . :
rJMSF021G15+ TTGCTGTCTGAGCTAATGCCATCGCTCAAATGGCTTGATGGTCAAAAGCTCCGATAAGTT
                      ____________________________________________________________
consensus TTGCTGTCTGAGCTAATGCCATCGCTCAAATGGCTTGATGGTCAAAAGCTCCGATAAGTT
 
. : . : . : . : . : . :
rJMSF021G15+ TAAAGTGCCCTTCTTATTTTCTCGTGTACTTTTATGTAACCAGTGACTACAGATGAACCT
                      ____________________________________________________________
consensus TAAAGTGCCCTTCTTATTTTCTCGTGTACTTTTATGTAACCAGTGACTACAGATGAACCT