Previous Contig 012188:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN043F09Sequence340012188 (4)gb:ZEL312053_17313759e-15Zinnia elegans mRNA for HD-Zip protein (hb1 gene).
JMSF002P08Sequence222005976 (10)725012188 (4)gb:ZEL312055_17313772e-67Zinnia elegans mRNA for HD-Zip protein (hb3 gene), clone 3.
JMSF017A01Sequence457005976 (10)553012188 (4)gb:ZEL312053_17313752e-46Zinnia elegans mRNA for HD-Zip protein (hb1 gene).
JMSF021F14Sequence654005976 (10)778012188 (4)gb:ZEL312055_17313779e-75Zinnia elegans mRNA for HD-Zip protein (hb3 gene), clone 3.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF021F14+ A
                      ____________________________________________________________
consensus A
 
. : . : . : . : . : . :
rJMSF002P08+ AAAGGTGTC
rJMSF021F14+ AAGAGTTGCAATGGCAATATCTCCGACAGGATTTGGTCCTACTCTTGGACCAAAGGTGTC
                      ____________________________________________________________
consensus AAGAGTTGCAATGGCAATATCTCCGACAGGATTTGGTCCTACTCTTGGACCAAAGGTGTC
 
. : . : . : . : . : . :
rJMSF002P08+ ACCTGGCTCCCCAGAAGCTCTAACACTGGCTCAGTGGATCAACCAGAGCTATAGTTATCA
rJMSF021F14+ ACCTGGCTCCCCAGAAGCTCTAACACTGGCTCAGTGGATCAACCAGAGCTATAGTTATCA
                      ____________________________________________________________
consensus ACCTGGCTCCCCAGAAGCTCTAACACTGGCTCAGTGGATCAACCAGAGCTATAGTTATCA
 
. : . : . : . : . : . :
rJMSF017A01+ TGAATCAGNGTTGAAAAATCT
rJMSF002P08+ CATGGGAGCACAATTGCTAGGAACTGATTCTGTGGGCGCTGAATCAGTGTTGAAAAATCT
rJMSF021F14+ CATGGGAGCACAATTGCTAGGAACTGATTCTGTGGGCGCTGAATCAGTGTTGAAAAATCT
                      ____________________________________________________________
consensus CATGGGAGCACAATTGCTAGGAACTGATTCTGTGGGCGCTGAATCAGTGTTGAAAAATCT
 
. : . : . : . : . : . :
rJMSF017A01+ CTGGCATCACCANGATGCCATNTTGTGNTNCTCCATAAAGTCGCTGCCGGTTNTCATCTT
rJMSF002P08+ CTGGCATCACCATGATGCCATCTTGTGCTGCTCCATAAAGTCGCTGCCGGTTTTCATCTT
rJMSF021F14+ CTGGCATCACCATGATGCCATCTTGTGCTGCTCCATAAAGTCGCTGCCGGTTTTCATCTT
                      ____________________________________________________________
consensus CTGGCATCACCATGATGCCATCTTGTGCTGCTCCATAAAGTCGCTGCCGGTTTTCATCTT
 
. : . : . : . : . : . :
JMFN043F09- AAACAACTTTACTCGCTCTACAGGATATCCC
rJMSF017A01+ TGCAAACAAGGNTGGGCTGGACATGCTCGAAACAACTTTACTCGCTCTACAGGATATCNC
rJMSF002P08+ TGCAAACAAGGCTGGGCTGGACATGCTCGAAACAACTTTACTCGCTCTACAGGATATCAC
rJMSF021F14+ TGCAAACAAGGCTGGGCTGGACATGCTCGAAACAACTTTACTCGCTCTACAGGATATCAC
                      ____________________________________________________________
consensus TGCAAACAAGGCTGGGCTGGACATGCTCGAAACAACTTTACTCGCTCTACAGGATATCAC
 
. : . : . : . : . : . :
JMFN043F09- CTTGCGATAAAATCTTTGACCAATCACGGCGCAAGGTACTATTTGCTCAACTCCCAAAGA
rJMSF017A01+ ATTG-GATAAAATCTTTGACGAATCAGGGCGCAAGGCACTATTTGCTGAACTCGCAAAGA
rJMSF002P08+ ATTG-GATAAAATCTTTGACGAATCAGGGCGCAAGGCACTATTTGCTGAACTCGCAAAGA
rJMSF021F14+ ATTG-GATAAAATCTTTGACGAATCAGGGCGCAAGGCACTATTTGCTGAACTCGCAAAGA
                      ____________________________________________________________
consensus ATTG-GATAAAATCTTTGACGAATCAGGGCGCAAGGCACTATTTGCTGAACTCGCAAAGA
 
. : . : . : . : . : . :
JMFN043F09- TCATGCAACCCGGATTTGCTTACTTGCCTGAAGGACTCTGCATCTCCACCCATGGGACGC
rJMSF017A01+ TCATGCAACAGGGTTTTGCTTACTTGCCTGGCGGACTCTGCATGT-CAGCCATGGGACGC
rJMSF002P08+ TCATGCAACAGGGTTTTGCTTACTTGCCTGGCGGACTCTGCATGT-CAGCCATGGGACGC
rJMSF021F14+ TCATGCAACAGGGTTTTGCTTACTTGCCTGGCGGACTCTGCATGT-CAGCCATGGGACGC
                      ____________________________________________________________
consensus TCATGCAACAGGGTTTTGCTTACTTGCCTGGCGGACTCTGCATGT-CAGCCATGGGACGC
 
. : . : . : . : . : . :
JMFN043F09- CACATTTCCTATGAACAAGCCATAGCATGGAAAGCCCTCGCCCACAACGAAAGCACTGTC
rJMSF017A01+ CACATTTCATATGAACAAGCCATAGCATGGAAAGTCCTTGCAGACGACGAAAGCACTGTC
rJMSF002P08+ CACATTTCATATGAACAAGCCATAGCATGGAAAGTCCTTGCAGACGACGAAAGCACTGTC
rJMSF021F14+ CACATTTCATATGAACAAGCCATAGCATGGAAAGTCCTTGCAGACGACGAAAGCACTGTC
                      ____________________________________________________________
consensus CACATTTCATATGAACAAGCCATAGCATGGAAAGTCCTTGCAGACGACGAAAGCACTGTC
 
. : . : . : . : . : . :
JMFN043F09- ACCTGCCTGGCCTTTCTCTTTTATAAACT
rJMSF017A01+ CACTGCCTGG-CTTTCTCTTTTATAAACTAGTCGTTCGTTTAAATTNTTCNGTCGTNGTC
rJMSF002P08+ CACTGCCTGG-CTTTCTCTTTTATAAACTGGTCGTTCGTTTAAATTCTTCTGTCGTTGTC
rJMSF021F14+ CACTGCCTGG-CTTTCTCTTTTATAAACTGGTCGTTCGTTTAAATTCTTCTGTCGTTGTC
                      ____________________________________________________________
consensus CACTGCCTGG-CTTTCTCTTTTATAAACTGGTCGTTCGTTTAAATTCTTCTGTCGTTGTC
 
. : . : . : . : . : . :
rJMSF017A01+ AATGCGNTCATATGCCTCCCCTTTTTCCTCAATGATCAATTGGAAGCCGTAAAAGCGCTG
rJMSF002P08+ AATGCGCTCATATGCCTCCCCTTTTTCCTCAATGATCAATTGGAAGCCGTAAAAGCGCTG
rJMSF021F14+ AATGCGCTCATATGCCTCCCCTTTTTCCTCAATGATCAATTGGAAGCCGTAAAAGCGCTG
                      ____________________________________________________________
consensus AATGCGCTCATATGCCTCCCCTTTTTCCTCAATGATCAATTGGAAGCCGTAAAAGCGCTG
 
. : . : . : . : . : . :
rJMSF017A01+ AAGATGTTGATGAACAACCAAGGAGGGAAAAGNTTTGTTNCATTCCAAACCCAGTGAGGT
rJMSF002P08+ AAGATGTTGATGAACAACCAAGGAGGGAAAAGTTTTGTTGCATTCCAAACCCAGTGAGGT
rJMSF021F14+ AAGATGTTGATGAACAACCAAGGAGGGAAAAGTTTTGTTGCATTCCAAACCCAGTGAGGT
                      ____________________________________________________________
consensus AAGATGTTGATGAACAACCAAGGAGGGAAAAGTTTTGTTGCATTCCAAACCCAGTGAGGT
 
. : . : . : . : . : . :
rJMSF017A01+ CCTGCATTAGTGAGTGGTTTAATTTGTTAGATNGGGTGTGTGNTGCTGAGTTT
rJMSF002P08+ CCTGCATTAGTGAGTGGTTTAATTTGTTAGATTGGGTGTGTGGTGCTGAGTTTTTGTTTC
rJMSF021F14+ CCTGCATTAGTGAGTGGTTTAATTTGTTAGATTGGGTGTGTGGTGCTGAGTTTTTGTTTC
                      ____________________________________________________________
consensus CCTGCATTAGTGAGTGGTTTAATTTGTTAGATTGGGTGTGTGGTGCTGAGTTTTTGTTTC
 
. : . : . : . : . : . :
rJMSF002P08+ TCCATTGTAAAGTCTGCTAGCATAGATCTCTTTATTTATTCAAATCGCATTCTTT
rJMSF021F14+ TCCATTGTAAAGTCTGCTAGCATAGATCTCTTTATTTATTCAAATCGCATTCTTTAATCT
                      ____________________________________________________________
consensus TCCATTGTAAAGTCTGCTAGCATAGATCTCTTTATTTATTCAAATCGCATTCTTTAATCT