Previous Contig 012181:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF015H14Sequence101018928759012181 (2)pir|C96767|C967671e-43unknown protein F2P9.17 [imported] - Arabidopsis thaliana>gb:AE005173_894941 Ara
JMSF021D09Sequence691019199pir|H86197|H861971e-55hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889640 Arabid805012181 (2)gb:AP005067_18475013e-33Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P048

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF015H14+ TAACCAAATAAGGCGTGCACGCTGTTGGTTTCCTTGCATGGAT
                      ____________________________________________________________
consensus TAACCAAATAAGGCGTGCACGCTGTTGGTTTCCTTGCATGGAT
 
. : . : . : . : . : . :
rJMSF015H14+ GACAATTTGCAGCGCTGCTGCTATGATTTGGAGTTCACAGTAGCCAGTAATCTTGTTGCA
                      ____________________________________________________________
consensus GACAATTTGCAGCGCTGCTGCTATGATTTGGAGTTCACAGTAGCCAGTAATCTTGTTGCA
 
. : . : . : . : . : . :
rJMSF015H14+ ATTAGCTCTGGGACTTTACTTTATCAGGTCTTGAGCAAAGATGATCCTTCGTGTAAAACA
                      ____________________________________________________________
consensus ATTAGCTCTGGGACTTTACTTTATCAGGTCTTGAGCAAAGATGATCCTTCGTGTAAAACA
 
. : . : . : . : . : . :
rJMSF015H14+ TTTGTCTATAGATTAGACGTTCCTGTTACGGCTGGATGGATATCCTTGACCATAGAGACA
                      ____________________________________________________________
consensus TTTGTCTATAGATTAGACGTTCCTGTTACGGCTGGATGGATATCCTTGACCATAGAGACA
 
. : . : . : . : . : . :
rJMSF015H14+ AGGATTAAACTTGCTTATGCTCTTGCAAGACAATGGTTTGGAGTATATATCACCTCTGAA
                      ____________________________________________________________
consensus AGGATTAAACTTGCTTATGCTCTTGCAAGACAATGGTTTGGAGTATATATCACCTCTGAA
 
. : . : . : . : . : . :
rJMSF015H14+ ACACCAAATGATGATTGGTTGTTGGATGGCCTTGCTGGATTTTTAACCGATACATTTATT
                      ____________________________________________________________
consensus ACACCAAATGATGATTGGTTGTTGGATGGCCTTGCTGGATTTTTAACCGATACATTTATT
 
. : . : . : . : . : . :
rJMSF015H14+ AAGAGATTCCTGGGAAATAATGAAGCACGATATCGGCGGTACAAGATTGTTGATGCTCTT
rJMSF021D09+ GATTGCTGATGCTCTT
                      ____________________________________________________________
consensus AAGAGATTCCTGGGAAATAATGAAGCACGATATCGGCGGTACAAGATTGTTGATGCTCTT
 
. : . : . : . : . : . :
rJMSF015H14+ TACTATAACCCTTCATTTACGCTGAGCATACTGCAAAAGCTTGGTGTTGCTACAGAGATC
rJMSF021D09+ TACTATAACCCTTCATTTACGCTGAGCATACTGCAAAAGCTTGGTGTTGCTACAGAGATC
                      ____________________________________________________________
consensus TACTATAACCCTTCATTTACGCTGAGCATACTGCAAAAGCTTGGTGTTGCTACAGAGATC
 
. : . : . : . : . : . :
rJMSF015H14+ TTCAATCTTTGGTTCCATATGCTACAACAAACTAAAAAAAGTGGAGCTCGGGCTAATTCT
rJMSF021D09+ TTCAATCTTTGGTTCCATATGCTACAACAAACTAAAAAAAGTGGAGCTCGGGCTAATTTT
                      ____________________________________________________________
consensus TTCAATCTTTGGTTCCATATGCTACAACAAACTAAAAAAAGTGGAGCTCGGGCTAATTTT
 
. : . : . : . : . : . :
rJMSF015H14+ AAAAGGGAGCATGAGAAGAAGGTTTCCTACTTGGGCTTGACATCATTGCTCAGTCTTCCT
rJMSF021D09+ AAAAGGGAGCATGAGAAGAAGGTTTACTGCTTGGGCTTGACCTCATTGCTCAGTCTTCCT
                      ____________________________________________________________
consensus AAAAGGGAGCATGAGAAGAAGGTTTCCTGCTTGGGCTTGACCTCATTGCTCAGTCTTCCT
 
. : . : . : . : . : . :
rJMSF015H14+ GC
rJMSF021D09+ GCTGATCAAATGCCAGCAGCAGCCTTAGAGGGCATTTTTAAGGCTATTCTTGATCTCCTT
                      ____________________________________________________________
consensus GCTGATCAAATGCCAGCAGCAGCCTTAGAGGGCATTTTTAAGGCTATTCTTGATCTCCTT
 
. : . : . : . : . : . :
rJMSF021D09+ GTTGCATACAAGGATCAACTTGCTGAAGCTGCAAAGGCTGATGAAGATGAAGATGAGATC
                      ____________________________________________________________
consensus GTTGCATACAAGGATCAACTTGCTGAAGCTGCAAAGGCTGATGAAGATGAAGATGAGATC
 
. : . : . : . : . : . :
rJMSF021D09+ GAGATAGATGGGTTTCAAAGTGACGATGACGAGTCTGATAGAGACATGGCGGATGATGAT
                      ____________________________________________________________
consensus GAGATAGATGGGTTTCAAAGTGACGATGACGAGTCTGATAGAGACATGGCGGATGATGAT
 
. : . : . : . : . : . :
rJMSF021D09+ GAGGACGGAGATGAAGCTGACAGCCTAAAGCTCCAAAAGTTGGCAGCACAGGCGAGTGCT
                      ____________________________________________________________
consensus GAGGACGGAGATGAAGCTGACAGCCTAAAGCTCCAAAAGTTGGCAGCACAGGCGAGTGCT
 
. : . : . : . : . : . :
rJMSF021D09+ TTCCGCGCCATTGATGACGAGGATGACTCGTCTGATGATGATTTCAGTGACGACGAAGAG
                      ____________________________________________________________
consensus TTCCGCGCCATTGATGACGAGGATGACTCGTCTGATGATGATTTCAGTGACGACGAAGAG
 
. : . : . : . : . : . :
rJMSF021D09+ TTGCAGTCACCCATTGATGAGGTGGACCCTATTATTCTCTTCGTTGATTCCATCAAAGAG
                      ____________________________________________________________
consensus TTGCAGTCACCCATTGATGAGGTGGACCCTATTATTCTCTTCGTTGATTCCATCAAAGAG
 
. : . : . : . : . : . :
rJMSF021D09+ TCCCGGAGAAGGTCATGACATCAATGGAGAAACCCCCGTATACAATGCGTGTTTCAAGGA
                      ____________________________________________________________
consensus TCCCGGAGAAGGTCATGACATCAATGGAGAAACCCCCGTATACAATGCGTGTTTCAAGGA
 
. : . : . : . : . : . :
rJMSF021D09+ AGTCAGAACCGGATTACTATTTCGGCCAAGTACTGCCAGTACTCCAGCGAAGACGTGTAT
                      ____________________________________________________________
consensus AGTCAGAACCGGATTACTATTTCGGCCAAGTACTGCCAGTACTCCAGCGAAGACGTGTAT
 
. : . : . : . : . : . :
rJMSF021D09+ GTAGGCGAGCTCGTTTCTGCTATTAGTTCTTTTCCAATGCTCAAGAAAATATATTTTTTG
                      ____________________________________________________________
consensus GTAGGCGAGCTCGTTTCTGCTATTAGTTCTTTTCCAATGCTCAAGAAAATATATTTTTTG
 
. : . : . : . : . : . :
rJMSF021D09+ GCAGGTTTACCTCTTGTAGACAAAATTCATATGTTTTGATGATATTATTGTATTAAAGTA
                      ____________________________________________________________
consensus GCAGGTTTACCTCTTGTAGACAAAATTCATATGTTTTGATGATATTATTGTATTAAAGTA