Previous Contig 012180:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF021D02Sequence683005959 (2)751012180 (2)pir|T09048|T090482e-53probable mannan endo-1,4-beta-mannosidase (EC 3.2.1.78) - Arabidopsis thaliana>g
JMSF031O01Sequence630005959 (2)gb:BT008596_16398121e-38Arabidopsis thaliana clone RAFL15-32-B17 (R20994) putative glycosyl hydrolase fa697012180 (2)pir|T09048|T090482e-46probable mannan endo-1,4-beta-mannosidase (EC 3.2.1.78) - Arabidopsis thaliana>g

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF021D02+ TTATGGGCTGCTGATCTCGGGTCTGACTTCA
                      ____________________________________________________________
consensus TTATGGGCTGCTGATCTCGGGTCTGACTTCA
 
. : . : . : . : . : . :
rJMSF031O01+ ACCATAGATTTCGCCTCTGTTCATGTATACCCAGATCATT
rJMSF021D02+ TTCGGAATTCAAATCTCTCGACCATAGATTTCGCCTCTGTTCATGTATACCCAGATCATT
                      ____________________________________________________________
consensus TTCGGAATTCAAATCTCTCGACCATAGATTTCGCCTCTGTTCATGTATACCCAGATCATT
 
. : . : . : . : . : . :
rJMSF031O01+ GGTTCAAGAATCAAACTTTTCAAGACAAATTGAAGTTTACGANGAAGTGGATCCTTTCCC
rJMSF021D02+ GGTTCAAGAATCAAACTTTTCAAGACAAATTGAAGTTTACGAAGAAGTGGATCCTTTCCC
                      ____________________________________________________________
consensus GGTTCAAGAATCAAACTTTTCAAGACAAATTGAAGTTTACGAAGAAGTGGATCCTTTCCC
 
. : . : . : . : . : . :
rJMSF031O01+ ACATCGAAGATGGCGAGAGGGCACTGAAAAAGCCTATCATGTTCACCGAATTTGGATTGG
rJMSF021D02+ ACATCGAAGATGGCGAGAGGGCACTGAAAAAGCCTATCATGTTCACCGAATTTGGATTGG
                      ____________________________________________________________
consensus ACATCGAAGATGGCGAGAGGGCACTGAAAAAGCCTATCATGTTCACCGAATTTGGATTGG
 
. : . : . : . : . : . :
rJMSF031O01+ CAGGTGAAACCAAGGAAGTTGAGCCATACCAACGCGACAGATTCTTCAAGCTTATTCTCG
rJMSF021D02+ CAGGTGAAACCAAGGAAGTTGAGCCATACCAACGCGACAGATTCTTCAAGCTTATTCTCG
                      ____________________________________________________________
consensus CAGGTGAAACCAAGGAAGTTGAGCCATACCAACGCGACAGATTCTTCAAGCTTATTCTCG
 
. : . : . : . : . : . :
rJMSF031O01+ AGATCATGTACAAGTCTGCAAAGCACAACAAATCCGGGGCGGGGTCCGTCTTCTGGCAGT
rJMSF021D02+ AGATCATGTACAAGTCTGCAAAGCACAACAAATCCGGGGCGGGGTCCGTCTTCTGGCAGT
                      ____________________________________________________________
consensus AGATCATGTACAAGTCTGCAAAGCACAACAAATCCGGGGCGGGGTCCGTCTTCTGGCAGT
 
. : . : . : . : . : . :
rJMSF031O01+ TCCTCGTGGAAAGGATGGAAGAGTACAACGACGAGTTTGGCATCGTTCCTTGGGAGAGGG
rJMSF021D02+ TCCTCGTGGAAAGGATGGAAGAGTACAACGACGAGTTTGGCATCGTTCCTTGGGAGAGGG
                      ____________________________________________________________
consensus TCCTCGTGGAAAGGATGGAAGAGTACAACGACGAGTTTGGCATCGTTCCTTGGGAGAGGG
 
. : . : . : . : . : . :
rJMSF031O01+ CATCGACGTATAATCTCATCACCAACCACTCGTGTAGGCTTGCCGGAGTTCATGGTGTGC
rJMSF021D02+ CATCGACGTATAATCTCATCACCAACCACTCGTGTAGGCTTGCCGGAGTTCATGGTGTGC
                      ____________________________________________________________
consensus CATCGACGTATAATCTCATCACCAACCACTCGTGTAGGCTTGCCGGAGTTCATGGTGTGC
 
. : . : . : . : . : . :
rJMSF031O01+ TGCCTTCTCAGCAGGAACATTTGAAAAGCTTCTGTTCCAAGACACAATAATCTTATGAGT
rJMSF021D02+ TGCCTTCTCAGCAGGAACATTTGAAAAGCTTCTGTTCCAAGACACAATAATCTTATGAGT
                      ____________________________________________________________
consensus TGCCTTCTCAGCAGGAACATTTGAAAAGCTTCTGTTCCAAGACACAATAATCTTATGAGT
 
. : . : . : . : . : . :
rJMSF031O01+ TTGTTTGTTTAGGCAGAAAATGATCAGGTTCATAACTTCATACTGTCATTATATTTATAT
rJMSF021D02+ TTGTTTGTTTAGGCAGAAAATGATCAGGTTCATAACTTCATACTGTCATTATATTTATAT
                      ____________________________________________________________
consensus TTGTTTGTTTAGGCAGAAAATGATCAGGTTCATAACTTCATACTGTCATTATATTTATAT
 
. : . : . : . : . : . :
rJMSF031O01+ ATATAGGTAAAAGAGAAATTTGGTTAGTTTGTTTTTGGTTTATGCTTTTGTGTTTTGAGG
rJMSF021D02+ ATATAGGTAAAAGAGAAATTTGGTTAGTTTGTTTTTGGTTTATGCTTTTGTGTTTTGAGG
                      ____________________________________________________________
consensus ATATAGGTAAAAGAGAAATTTGGTTAGTTTGTTTTTGGTTTATGCTTTTGTGTTTTGAGG
 
. : . : . : . : . : . :
rJMSF031O01+ TTGAGGTTGTCCTAGGTTATAGGCCATTGTTTTGTGCCCATGGAGATTTGGCATTTGCAG
rJMSF021D02+ TTGAGGTTGTCCTAGGTTATAGGCCATTGTTTTGTGCCCATGGAGATTTGGCATTTGCAG
                      ____________________________________________________________
consensus TTGAGGTTGTCCTAGGTTATAGGCCATTGTTTTGTGCCCATGGAGATTTGGCATTTGCAG
 
. : . : . : . : . : . :
rJMSF031O01+ ATTTGTGCAGAATGCACCCATGGCAATTTGTCATACAATGCAGCTGTAAAACTACTA
rJMSF021D02+ ATTTGTGCAGAATGCACCCATGGCAATTTGTCATACAATGCAGCTGTAAAACTACTACCC
                      ____________________________________________________________
consensus ATTTGTGCAGAATGCACCCATGGCAATTTGTCATACAATGCAGCTGTAAAACTACTACCC