Previous Contig 012169:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003H14Sequence302004518 (2)578012169 (2)gb:AC145811_17445192e-41Oryza sativa chromosome 3 BAC OSJNBb0088L13 genomic sequence, complete sequence.
JMSF020P19Sequence325004518 (2)732012169 (2)gb:AC145811_17445195e-43Oryza sativa chromosome 3 BAC OSJNBb0088L13 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF003H14+ CTCGTGATGC
rJMSF020P19+ CACTCGTGATGC
                      ____________________________________________________________
consensus CACTCGTGATGC
 
. : . : . : . : . : . :
rJMSF003H14+ TTCGATCTACATTGTAAGCTGGAACGACCACTTCTTTGTGCTGAAAGTCGAGCAAGATGC
rJMSF020P19+ TTCGATCTACATTGTAAGCTGGAACGACCACTTCTTTGTGCTGAAAGTCGAGCAAGATGC
                      ____________________________________________________________
consensus TTCGATCTACATTGTAAGCTGGAACGACCACTTCTTTGTGCTGAAAGTCGAGCAAGATGC
 
. : . : . : . : . : . :
rJMSF003H14+ ATACTACATCATCGACACATTGGGCGAGAGGCTATACGAGGGCTGCAACCAAGCCTTTAT
rJMSF020P19+ ATACTACATCATCGACACATTGGGCGAGAGGCTCTACGAGGGCTGCAACCAAGCCTTTAT
                      ____________________________________________________________
consensus ATACTACATCATCGACACATTGGGCGAGAGGCTCTACGAGGGCTGCAACCAAGCCTTTAT
 
. : . : . : . : . : . :
rJMSF003H14+ CCTCAGGTTCGACAGAGACACTACAATTTCACTGGTGGCTAACGAGACTCAACCCCCGAC
rJMSF020P19+ CCTCAGGTTCGACAGAGACACTACAATTTCACTGGTGGCTAACGAGACTCAACCCCCGAC
                      ____________________________________________________________
consensus CCTCAGGTTCGACAGAGACACTACAATTTCACTGGTGGCTAACGAGACTCAACCCCCGAC
 
. : . : . : . : . : . :
rJMSF003H14+ AGAAGACTCATCTGCTAGTGCTAAAACTGAGGATAATATCGTCAACGCCCCCAAGACAAA
rJMSF020P19+ AGAAGACTCATCTGCTAGTGCTAAAACTGAGGATAATATCGTCAACGCCCCCAAGACAAA
                      ____________________________________________________________
consensus AGAAGACTCATCTGCTAGTGCTAAAACTGAGGATAATATCGTCAACGCCCCCAAGACAAA
 
. : . : . : . : . : . :
rJMSF003H14+ CAACGAAGAATCGACTATGGGGGGCGAGCCTGACAATAACGAGCAAGAATCAATGGTATG
rJMSF020P19+ CAACGAAGAATCGACTATGGGGGGCGAGCCTGACAATAACGAGCAAGAATCAATGGTATG
                      ____________________________________________________________
consensus CAACGAAGAATCGACTATGGGGGGCGAGCCTGACAATAACGAGCAAGAATCAATGGTATG
 
. : . : . : . : . : . :
rJMSF003H14+ CAGAGGCAAAGACTCGTGCAAAGAGTACATTAAAAGTTTCTTGGCAGCAATCCCTATTCG
rJMSF020P19+ CAGAGGCAAAGACTCGTGCAAAGAGTACATTAAAAGTTTCTTGGCAGCAATCCCTATTCG
                      ____________________________________________________________
consensus CAGAGGCAAAGACTCGTGCAAAGAGTACATTAAAAGTTTCTTGGCAGCAATCCCTATTCG
 
. : . : . : . : . : . :
rJMSF003H14+ AGANNTACAAGTTGATCTTAAGAAGGGTTTGAGGCCATNGATGCCCCTTCATCAGCGGCT
rJMSF020P19+ AGAATTACAAGTTGATCTTAAGAAGGGTTTGAGGCCATCGATGCCCCTTCATCAGCGGCT
                      ____________________________________________________________
consensus AGAATTACAAGTTGATCTTAAGAAGGGTTTGAGGCCATCGATGCCCCTTCATCAGCGGCT
 
. : . : . : . : . : . :
rJMSF003H14+ TCAAATCGAATTCCATTATACGAATTACAAACTACTTTCACTCTGCGATGGAGGAGTAGA
rJMSF020P19+ TCAAATCGAATTCCATTATACGAATTACAAACTACTTTCACTCTGTGATGGAGGAGTAGA
                      ____________________________________________________________
consensus TCAAATCGAATTCCATTATACGAATTACAAACTACTTTCACTCTGTGATGGAGGAGTAGA
 
. : . : . : . : . : . :
rJMSF003H14+ ACCAAGTTCTGATNTCTAGGGAACANTATTGCAGAATTAGGANTAGTACATGAGNGTATA
rJMSF020P19+ ACCAAGTTCTGATCTCTAGGGAACATTATTGCAGAATTAGGATTAGTACATGAGAGTATA
                      ____________________________________________________________
consensus ACCAAGTTCTGATCTCTAGGGAACATTATTGCAGAATTAGGATTAGTACATGAGAGTATA
 
. : . : . : . : . : . :
rJMSF003H14+ TGAGTACATTACTAACCCCCTATCCCCT
rJMSF020P19+ TGAGTACATTACTAACCCCCTATCCCCTTTTTCATTCTATTTTTAGTGTTTTTACATATA
                      ____________________________________________________________
consensus TGAGTACATTACTAACCCCCTATCCCCTTTTTCATTCTATTTTTAGTGTTTTTACATATA
 
. : . : . : . : . : . :
rJMSF020P19+ TGATCTTAGACTGGATAAGCCCACTTGTGAGATATAACCTTTTTCTCTAAAGGGCATCTC
                      ____________________________________________________________
consensus TGATCTTAGACTGGATAAGCCCACTTGTGAGATATAACCTTTTTCTCTAAAGGGCATCTC
 
. : . : . : . : . : . :
rJMSF020P19+ TTTCTTTCTCCATAGAACATACATAAGAAGCTTCCTTGTTTGGTTGACAATTTTTCCTGT
                      ____________________________________________________________
consensus TTTCTTTCTCCATAGAACATACATAAGAAGCTTCCTTGTTTGGTTGACAATTTTTCCTGT