Previous Contig 012157:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF020N15Sequence646012157 (4)762012157 (4)
JMSF038C22Sequence676012157 (4)887012157 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF038C22- GAATTTGCTTGTTGTCTCTCTATGAGTTCTCTGCACAGCAACAACAA
JMSF020N15- GAATTTGCTTGTTGTCTCTCTATGAGTTCTCTGCACAGCAACAACAA
rJMSF038C22+ GAATTTGCTTGGTGTCTCTCTATGAGTTCTCTGCACAGCAACAACAA
                      ____________________________________________________________
consensus GAATTTGCTTGTTGTCTCTCTATGAGTTCTCTGCACAGCAACAACAA
 
. : . : . : . : . : . :
JMSF038C22- CAACAATGAGTTCCTCGTCTCGTTTCCATATGTTTCACCCGATTTCACCGTTTCCAGTTG
JMSF020N15- CAACAATGAGTTCCTCGTCTCGTTTCCATATGTTTCACCCGATTTCACCGTTTCCAGTTG
rJMSF038C22+ CAACAATGAGTTCCTCGTCTCGTTTCCATATGTTTCACCCGATTTCACCGTTTCCAGTTG
                      ____________________________________________________________
consensus CAACAATGAGTTCCTCGTCTCGTTTCCATATGTTTCACCCGATTTCACCGTTTCCAGTTG
 
. : . : . : . : . : . :
JMSF038C22- CAAACAAGGTTGATGGGCCGCCGTAGAGTGCCGGAATTTCTGGCAATTTTTTGATTTGTG
JMSF020N15- CAAACAAGGTTGATGGGCCGCCGTAGAGTGCCGGAATTTCTGGCAATTTTTTGATTTGTG
rJMSF038C22+ CAAACAAGGTTGATGGGCCGCCGTAGAGTGCCGGAATTTCTGGCAATTTTTTGATTTGTG
rJMSF020N15+ CGCCGTAGAGTGCCGGAATTTCTGGCAATTTTTTGATTTGTG
                      ____________________________________________________________
consensus CAAACAAGGTTGATGGGCCGCCGTAGAGTGCCGGAATTTCTGGCAATTTTTTGATTTGTG
 
. : . : . : . : . : . :
JMSF038C22- AGGAGGTGAAGGGAGGAGAAGATGGGGATAAATCTCCAGTTCTTAAAGGGATTGCGACGG
JMSF020N15- AGGAGGTGAAGGGAGGAGAAGATGGGGATAAATCTCCAGTTCTTAAAGGGATTGCGACGG
rJMSF038C22+ AGGAGGTGAAGGGAGGAGAAGATGGGGATAAATCTCCAGTTCTTAAAGGGATTGCGACGG
rJMSF020N15+ AGGAGGTGAAGGGAGGAGAAGATGGGGATAAATCTCCAGTTCTTAAAGGGATTGCGACGG
                      ____________________________________________________________
consensus AGGAGGTGAAGGGAGGAGAAGATGGGGATAAATCTCCAGTTCTTAAAGGGATTGCGACGG
 
. : . : . : . : . : . :
JMSF038C22- GTTGATGACATGCAATCGTTCCACTCGATTTCGCTGTTTCCAGTTGCGAAACAGGTTGAT
JMSF020N15- GTTGATGACATGCAATCGTTCCACTCGATTTCGCTGTTTCCAGTTGCGAAACAGGTTGAT
rJMSF038C22+ GTTGATGACATGCAATCGTTCCACTCGATTTCGCTGTTTCCAGTTGCGAAACAGGTTGAT
rJMSF020N15+ GTTGATGACATGCAATCGTTCCACTCGATTTCGCTGTTTCCAGTTGCGAAACAGGTTGAT
                      ____________________________________________________________
consensus GTTGATGACATGCAATCGTTCCACTCGATTTCGCTGTTTCCAGTTGCGAAACAGGTTGAT
 
. : . : . : . : . : . :
JMSF038C22- GGGCCGCCGCCGTCGCTGTAGAGTGCCGGAATTTCTAGGGTTGTTTCGGTTTGTGAGGAG
JMSF020N15- GGGCCGCCGCCGTCGCTGTAGAGTGCCGGAATTTCTAGGGTTGTTTCGGTTTGTGAGGAG
rJMSF038C22+ GGGCCGCCGCCGTCGCTGTAGAGTGCCGGAATTTCTAGGGTTGTTTCGGTTTGTGAGGAG
rJMSF020N15+ GGGCCGCCGCCGTCGCTGTAGAGTGCCGGAATTTCTAGGGTTGTTTCGGTTTGTGAGGAG
                      ____________________________________________________________
consensus GGGCCGCCGCCGTCGCTGTAGAGTGCCGGAATTTCTAGGGTTGTTTCGGTTTGTGAGGAG
 
. : . : . : . : . : . :
JMSF038C22- GTAAAGGGAGAGGAGATGGGGAGAAATCTCCGATTCTTGAAGGGATTGCGGCGGTGGCGG
JMSF020N15- GTAAAGGGAGAGGAGATGGGGAGAAATCTCCGATTCTTGAAGGGATTGCGGCGGTGGCGG
rJMSF038C22+ GTAAAGGGAGAGGAGATGGGGAGAAATCTCCGATTCTTGAAGGGATTGCGGCGGTGGCGG
rJMSF020N15+ GTAAAGGGAGAGGAGATGGGGAGAAATCTCCGATTCTTGAAGGGATTGCGGCGGTGGCGG
                      ____________________________________________________________
consensus GTAAAGGGAGAGGAGATGGGGAGAAATCTCCGATTCTTGAAGGGATTGCGGCGGTGGCGG
 
. : . : . : . : . : . :
JMSF038C22- GGGAGCGTGTGCTTTTTTGCCGCATCGAGAGTTTGAGGGACGAGGAGAGCGTTAATATAT
JMSF020N15- GGGAGCGTGTGCTTTTTTGCCGCATCGAGAGTTTGAGGGACGAGGAGAGCGTTAATATAT
rJMSF038C22+ GGGAGCGTGTGCTTTTTTGCCGCATCGAGAGTTTGAGGGACGAGGAGAGCGTTAATATAT
rJMSF020N15+ GGGAGCGTGTGCTTTTTTGCCGCATCGAGAGTTTGAGGGACGAGGAGAGCGTTAATATAT
                      ____________________________________________________________
consensus GGGAGCGTGTGCTTTTTTGCCGCATCGAGAGTTTGAGGGACGAGGAGAGCGTTAATATAT
 
. : . : . : . : . : . :
JMSF038C22- AATCCTTCGCCCTTCAGCCCTGCGATTCAGTCGTCTATCTATCTCTCCACCGCCGATTAT
JMSF020N15- AATCCTTCGCCCTTCAGCCCTGCGATTCAGTCGTCTATCTATCTCTCCACCGCCGATTAT
rJMSF038C22+ AATCCTTCGCCCTTCAGCCCTGCGATTCAGTCGTCTATCTATCTCTCCACCGCCGATTAT
rJMSF020N15+ AATCCTTCGCCCTTCAGCCCTGCGATTCAGTCGTCTATCTATCTCTCCACCGCCGATTAT
                      ____________________________________________________________
consensus AATCCTTCGCCCTTCAGCCCTGCGATTCAGTCGTCTATCTATCTCTCCACCGCCGATTAT
 
. : . : . : . : . : . :
JMSF038C22- CCAGTCTCCTCCACTCAGCTCCACCGGCGGCCGACCTTAGTCTTCTCCGTCTGGCGTCTA
JMSF020N15- CCAGTCTCCTCCACTCAGCTCCACCGGCGGCCGACCTTAGTCTTCTCCGTCTGGCGTCTA
rJMSF038C22+ CCAGTCTCCTCCACTCAGCTCCACCGGCGGCCGACCTTAGTCTTCTCCGTCTGGCGTCTA
rJMSF020N15+ CCAGTCTCCTCCACTCAGCTCCACCGGCGGCCGACCTTAGTCTTCTCCGTCTGGCGTCTA
                      ____________________________________________________________
consensus CCAGTCTCCTCCACTCAGCTCCACCGGCGGCCGACCTTAGTCTTCTCCGTCTGGCGTCTA
 
. : . : . : . : . : . :
JMSF038C22- CTACTCTG
JMSF020N15- CTACTCTGCTCCATAGCTAATCTTCAAGTGGAAGAGCATTCCGTTTCCCTTCGGCTTTT
rJMSF038C22+ CTACTCTGCTCCATAGCTAATCTTCAAGTGGAAGAGCATTCCGTTTCCCTTCGGCTTTTT
rJMSF020N15+ CTACTCTGCTCCATAGCTAATCTTCAAGTGGAAGAGCATTCCGTTTCCCTTCGGCTTTTT
                      ____________________________________________________________
consensus CTACTCTGCTCCATAGCTAATCTTCAAGTGGAAGAGCATTCCGTTTCCCTTCGGCTTTTT
 
. : . : . : . : . : . :
rJMSF038C22+ TGATTTGAGTGTTTGCGGCTGGCATCGAGAGTGTATGTTTTTGCGTTTCTGTATGTCTGT
rJMSF020N15+ TGATTTGAGTGTTTGCGGCTGGCATCGAGAGTGTATGTTTTTGCGTTTCTGTATGTCTGT
                      ____________________________________________________________
consensus TGATTTGAGTGTTTGCGGCTGGCATCGAGAGTGTATGTTTTTGCGTTTCTGTATGTCTGT
 
. : . : . : . : . : . :
rJMSF038C22+ GCCGTCTGTTTGTATGCACGGGATTGAATTTTGATTGGTATGTGGCTTGGTTGAGGTCGT
rJMSF020N15+ GCCGTCTGTTTGTATGCACGGGATTGAATTTTGATTGGTATGTGGCTTGGTTGAGGTCGT
                      ____________________________________________________________
consensus GCCGTCTGTTTGTATGCACGGGATTGAATTTTGATTGGTATGTGGCTTGGTTGAGGTCGT
 
. : . : . : . : . : . :
rJMSF038C22+ TTCATGTTTATTGTTTATTGAGGTGGTTTGATTTGAAGTAGTACTAAGGTTCTATATAAG
rJMSF020N15+ TTCATGTTTATTGTTTATTGAGGTGGTTTGATTTGAAGTAGTACTAAGGTTCTATATAAG
                      ____________________________________________________________
consensus TTCATGTTTATTGTTTATTGAGGTGGTTTGATTTGAAGTAGTACTAAGGTTCTATATAAG
 
. : . : . : . : . : . :
rJMSF038C22+ GTTCTATTGTCAGATGGGTGTAATTAAATAGTCTACCTGGTTGCCATCTTCTTATTGATG
rJMSF020N15+ GTTCTATTGTCAGATGGGTGTAATTAAATAGTCTACCTGGTTGCCATCTTCTTATTGATG
                      ____________________________________________________________
consensus GTTCTATTGTCAGATGGGTGTAATTAAATAGTCTACCTGGTTGCCATCTTCTTATTGATG