Previous Contig 012153:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF020M07Sequence680019180gb:ATAC009325_15428990.008Arabidopsis thaliana chromosome III BAC F4P13 genomic sequence, complete sequenc781012153 (3)gb:AJ843981_18146735e-38Plantago major partial mRNA for hypothetical protein.
JMSF031M17Sequence630006763 (8)704012153 (3)gb:AJ843981_18146732e-33Plantago major partial mRNA for hypothetical protein.
JMSF050I24Sequence289006763 (8)677012153 (3)gb:AJ843981_18146731e-28Plantago major partial mRNA for hypothetical protein.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF020M07+ CTCT
                      ____________________________________________________________
consensus CTCT
 
. : . : . : . : . : . :
rJMSF020M07+ AGAAATGCTTTATGNTGGGAAGATGAATGTAAAAGAAAGGATCAAAAGGAACAGTGGCAC
                      ____________________________________________________________
consensus AGAAATGCTTTATGNTGGGAAGATGAATGTAAAAGAAAGGATCAAAAGGAACAGTGGCAC
 
. : . : . : . : . : . :
rJMSF050I24+ TTGAGCAGCATCCTTCAAGACCCANCCATGATCNGGTTCTTCTG
rJMSF031M17+ GAGGGTTTGAGCAGCATCCTTCAAGACCCAACCATGATTTGGTTCTTCTG
rJMSF020M07+ AATACAGGAGGAGGGGTTGAGCAGCATCCTTCAAGACCCAACCATGATTTGGTTCTTCTG
                      ____________________________________________________________
consensus AATACAGGAGGAGGGTTTGAGCAGCATCCTTCAAGACCCAACCATGATTTGGTTCTTCTG
 
. : . : . : . : . : . :
rJMSF050I24+ GGAGAGGCTAGAGAGCATGTGNTTCCTCAAAGGAGAAANGACCCNTGCAATGCAAGATAA
rJMSF031M17+ GGAGAGGCTAGAGAGCATGTGGTTCCTCAAAGGAGAAAAGACCCCTGCAATGCAAGATAA
rJMSF020M07+ GGAGAGGCTAGAGAGCATGTGGTTCCTCAAAGGAGAAAAAACTATGGCAATGCAAGA---
                      ____________________________________________________________
consensus GGAGAGGCTAGAGAGCATGTGGTTCCTCAAAGGAGAAAAGACCCTTGCAATGCAAGATAA
 
. : . : . : . : . : . :
rJMSF050I24+ TGACACTNGGACTTACNTTNTCCNTGAGGAGAGCAGGGACCCCATTNTNCAGCAAGTGAA
rJMSF031M17+ TGACACTAGGACTTACATTATCCCTGAGGAGAGCAGGGACCCCATTCTGCAGCAAGTGAA
rJMSF020M07+ TGATTCCAGAACTTACATTATCCCTGAAGAGAGCAGGGACCCCATTCTGCAGCAAGTGAA
                      ____________________________________________________________
consensus TGACACTAGGACTTACATTATCCCTGAGGAGAGCAGGGACCCCATTCTGCAGCAAGTGAA
 
. : . : . : . : . : . :
rJMSF050I24+ AGCCATCNTCAGNTACGNCGGCAGCAACCGTGGCTGGGCGGTGTTTAGCCGAGGCCTGGC
rJMSF031M17+ AGCCATCCTCAGCTACGACGGCAGCAACCGTGGCTGGGCGGTGTTTAGCCGAGGCCTGGC
rJMSF020M07+ AGCCATCCTCAGCTACGATGGCAGCAACCGATGCTGGGCAGTGTTTAGCAGAGGGTTGGG
                      ____________________________________________________________
consensus AGCCATCCTCAGCTACGACGGCAGCAACCGTGGCTGGGCGGTGTTTAGCCGAGGCCTGGC
 
. : . : . : . : . : . :
rJMSF050I24+ TGAGATGACCAAAGGGGAAGGCAGCAATGTGGTAAAAGTGTTGAATAACTTTGATAGCTG
rJMSF031M17+ TGAGATGACCAAAGGGGAAGGCAGCAATGTGGTAAAAGTGTTGAATAACTTTGATAGCTG
rJMSF020M07+ TGAAATGACCAAAGGGGAAGGCAGCAATGTGGTAAAAGTGTTGAGCAACTATGATAGCTG
                      ____________________________________________________________
consensus TGAGATGACCAAAGGGGAAGGCAGCAATGTGGTAAAAGTGTTGAATAACTTTGATAGCTG
 
. : . : . : . : . : . :
rJMSF050I24+ GAGACATGAAGTGACTGATGAGAATGCATTTATCCCTGCACTGGATAAACAGCTTCGTGG
rJMSF031M17+ GAGACATGAAGTGACTGATGAGAATGCATTTATCCCTGCACTGGATAAACAGCTTCGTGG
rJMSF020M07+ GAAGCATGAAGTGACTGATGTGAATGCGTTTATCCCTGCTCTGGATAAGCAGCTTCGTGG
                      ____________________________________________________________
consensus GAGACATGAAGTGACTGATGAGAATGCATTTATCCCTGCACTGGATAAACAGCTTCGTGG
 
. : . : . : . : . : . :
rJMSF050I24+ GCNGNATACTAAGCACCACTGCACCCGCATGGTTGTGCCGGCGGCGGTGGGACACTACCC
rJMSF031M17+ GCTGTATACTAAGCACCACTGCACCCGCATGGTTGTGCCGGCGGCGGTGGGACACTACCC
rJMSF020M07+ GCTGTATACTAAGCACCACTGCACCCGCATGGTGGTGCCGGCGGCGGTGGGGCACTACCC
                      ____________________________________________________________
consensus GCTGTATACTAAGCACCACTGCACCCGCATGGTTGTGCCGGCGGCGGTGGGACACTACCC
 
. : . : . : . : . : . :
rJMSF050I24+ GGAGACGGTGGCTTGCGTGGAGTGTGGGCGTTCCATGGAGAAGTTCTTCATGTATAGCTG
rJMSF031M17+ GGAGACGGTGGCTTGCGTGGAGTGTGGGCGTTCCATGGAGAAGTTCTTCATGTATAGCTG
rJMSF020M07+ GGAGACGGTGGCTTGCGTGGAGTGCGGGCGAACCATGGAAAAGTTCTTCATGTATAGTTG
                      ____________________________________________________________
consensus GGAGACGGTGGCTTGCGTGGAGTGTGGGCGTTCCATGGAGAAGTTCTTCATGTATAGCTG
 
. : . : . : . : . : . :
rJMSF050I24+ CTGCCTGGATGAGTATGA
rJMSF031M17+ CTGCCTGGATGAGTATGA
rJMSF020M07+ CTGCCTGGATGAGTATGAAAATTAAATTCTGCCACAAATTAAATGCCATCCAGACCGGTC
                      ____________________________________________________________
consensus CTGCCTGGATGAGTATGAAAATTAAATTCTGCCACAAATTAAATGCCATCCAGACCGGTC
 
. : . : . : . : . : . :
rJMSF020M07+ CGCTAATTCCATCCAAATAAAGATCTTCGTTCTATCTTCAGATCCATTATTGGTGTCTCC
                      ____________________________________________________________
consensus CGCTAATTCCATCCAAATAAAGATCTTCGTTCTATCTTCAGATCCATTATTGGTGTCTCC
 
. : . : . : . : . : . :
rJMSF020M07+ TCCACCATACTTTTTGTTACAGTGTGTTATGTAAAATAAAGAATGTAAGAAAGATGCAGG
                      ____________________________________________________________
consensus TCCACCATACTTTTTGTTACAGTGTGTTATGTAAAATAAAGAATGTAAGAAAGATGCAGG
 
. : . : . : . : . : . :
rJMSF020M07+ ATATGATGCATCATTTCACTGGTTTTCCTCTATTATTAGCACTTAGATTGTTGTATGGGA
                      ____________________________________________________________
consensus ATATGATGCATCATTTCACTGGTTTTCCTCTATTATTAGCACTTAGATTGTTGTATGGGA