Previous Contig 012145:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF020J16Sequence694012145 (6)gb:AC005970_15333032e-52Arabidopsis thaliana chromosome 2 clone T6P5 map mi310, complete sequence.>gb:AY775012145 (6)gb:AY094415_15757177e-49Arabidopsis thaliana At2g06010/F5K7.23 mRNA, complete cds.
JMSF035B19Sequence693012145 (6)gb:AC005970_15333031e-68Arabidopsis thaliana chromosome 2 clone T6P5 map mi310, complete sequence.>gb:AY722012145 (6)gb:AY094415_15757172e-60Arabidopsis thaliana At2g06010/F5K7.23 mRNA, complete cds.
JMSF041F04Sequence733012145 (6)gb:AC005970_15333033e-69Arabidopsis thaliana chromosome 2 clone T6P5 map mi310, complete sequence.>gb:AY864012145 (6)gb:AC005970_15333037e-75Arabidopsis thaliana chromosome 2 clone T6P5 map mi310, complete sequence.>gb:AY

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF020J16- GAAAACT
                      ____________________________________________________________
consensus GAAAACT
 
. : . : . : . : . : . :
JMSF020J16- GAATTACAGTGGCGTGAGGCGGGGCAATTTGAGATTCTACTCGGAGAAGAAGAGAAAAAT
JMSF035B19- GGAGAAGAAGAGAAAAAT
JMSF041F04- ACAGTGGCGTGAGGCGGGGCAATTTGAGATTCTACTCGGAGAAGAAGAGAAAAAT
                      ____________________________________________________________
consensus GAATTACAGTGGCGTGAGGCGGGGCAATTTGAGATTCTACTCGGAGAAGAAGAGAAAAAT
 
. : . : . : . : . : . :
JMSF020J16- GTCAACTGAAAGGCATAGTTCTGGGACCTTCGCATCTCCTGAAGAAAATACTCTATTCCT
JMSF035B19- GTCAACTGAAAGGCATAGTTCTGGGACCTTCGCATCTCCTGAAGAAAATACTCTATTCCT
JMSF041F04- GTCAACTGAAAGGCATAGTTCTGGGACCTTCGCATCTCCTGAAGAAAATACTCTATTCCT
                      ____________________________________________________________
consensus GTCAACTGAAAGGCATAGTTCTGGGACCTTCGCATCTCCTGAAGAAAATACTCTATTCCT
 
. : . : . : . : . : . :
JMSF020J16- TGACATACTACACGAGGCACCTTTATTTGGTCATCGGAAGCCTACAAGGATTGTTGGGAG
JMSF035B19- TGACATACTACACGAGGCACCTTTATTTGGTCATCGGAAGCCTACAAGGATTGTTGGGAG
JMSF041F04- TGACATACTACACGAGGCACCTTTATTTGGTCATCGGAAGCCTACAAGGATTGTTGGGAG
                      ____________________________________________________________
consensus TGACATACTACACGAGGCACCTTTATTTGGTCATCGGAAGCCTACAAGGATTGTTGGGAG
 
. : . : . : . : . : . :
JMSF020J16- CATTCTCTACTGTTTTCTATT----GGTTTTGCTAGTTTGGCTGTTGGAGCTACTTGGAT
JMSF035B19- CATTCTCTACTGTTTTCTATTGGCAGGTTTTGCTAGTTTGGCTGTTGGAGCTACTTGGAT
JMSF041F04- CATTCTCTACTGTTTTCTATTGGCAGGTTTTGCTAGTTTGGCTGTTGGAGCTACTTGGAT
                      ____________________________________________________________
consensus CATTCTCTACTGTTTTCTATTGGCAGGTTTTGCTAGTTTGGCTGTTGGAGCTACTTGGAT
 
. : . : . : . : . : . :
JMSF020J16- ATTTCATCCTATAAAAGAATTAGTTTCTCCCCTGCTGTGCAGTTTTAATGTTATCCTTCT
JMSF035B19- ATTTCATCCTATAAAAGAATTAGTTTCTCCCCTGCTGTGCAGTTTTAATGTTATCCTTCT
JMSF041F04- ATTTCATCCTATAAAAGAATTAGTTTCTCCCCTGCTGTGCAGTTTTAATGTTATCCTTCT
                      ____________________________________________________________
consensus ATTTCATCCTATAAAAGAATTAGTTTCTCCCCTGCTGTGCAGTTTTAATGTTATCCTTCT
 
. : . : . : . : . : . :
JMSF020J16- GTTTACCACAGGCATTTTTCAACAATACCTAGTATACCAAGTGAAAAAAATCCGACTACA
JMSF035B19- GTTTACCACAGGCATTTTTCAACAATACCTAGTATACCAAGTGAAAAAAATCCGACTACA
JMSF041F04- GTTTACCACAGGCATTTTTCAACAATACCTAGTATACCAAGTGAAAAAAATCCGACTACA
                      ____________________________________________________________
consensus GTTTACCACAGGCATTTTTCAACAATACCTAGTATACCAAGTGAAAAAAATCCGACTACA
 
. : . : . : . : . : . :
JMSF020J16- GGGCTACTACATTTTCAGCCAGAAGTTGAAGCATATAATCCGTTTACCATTTGCCACGAT
JMSF035B19- GGGCTACTACATTTTCAGCCAGAAGTTGAAGCATATAATCCGTTTACCATTTGCCACGAT
JMSF041F04- GGGCTACTACATTTTCAGCCAGAAGTTGAAGCATATAATCCGTTTACCATTTGCCACGAT
rJMSF041F04+ TTTTCAGCCAGAAGTTGAAGCATATAATCCGTTTACCATTTGCCACGAT
                      ____________________________________________________________
consensus GGGCTACTACATTTTCAGCCAGAAGTTGAAGCATATAATCCGTTTACCATTTGCCACGAT
 
. : . : . : . : . : . :
JMSF020J16- TGCTTATGGAACTGCTGCAATGCTGCTTGTCATGGTTTGGAAACCACACATTAGCTTTCT
JMSF035B19- TGCTTATGGAACTGCTGCAATGCTGCTTGTCATGGTTTGGAAACCACACATTAGCTTTCT
JMSF041F04- TGCTTATGGAACTGCTGCAATGCTGCTTGTCATGGTTTGGAAACCACACATTAGCTTTCT
rJMSF041F04+ TGCTTATGGAACTGCTGCAATGCTGCTTGTCATGGTTTGGAAACCACACATTAGCTTTCT
                      ____________________________________________________________
consensus TGCTTATGGAACTGCTGCAATGCTGCTTGTCATGGTTTGGAAACCACACATTAGCTTTCT
 
. : . : . : . : . : . :
JMSF020J16- ATCCACGTCTACAATACTCAGGATCATTTTATTGGTCGAAGTTGTATGTGCTAGTTCCTT
JMSF035B19- ATCCACGTCTACAATACTCAGGATCATTTTATTGGTCGAAGTTGTATGTGCTAGTTCCTT
JMSF041F04- ATCCACGTCTACAATACTCAGGATCATTTTATTGGTCGAAGTTGTATGTGCTAGTTCCTT
rJMSF035B19+ TCAGGATCATTTTATTGTCGNAAGTTGTATGTGCTAGTTCCTT
rJMSF041F04+ ATCCACGTCTACAATACTCAGGATCATTTTATTGGTCGAAGTTGTATGTGCTAGTTCCTT
                      ____________________________________________________________
consensus ATCCACGTCTACAATACTCAGGATCATTTTATTGGTCGAAGTTGTATGTGCTAGTTCCTT
 
. : . : . : . : . : . :
JMSF020J16- CATCAGTGCTTATATTGGTTATGTCTATCAGTACAATTCACTTGATTCTCAACCTGATGT
JMSF035B19- CATCAGTGCTTATATTGGTTATGTCTATCAGTACAATTCACTTGATTCTCAACCTGATGT
JMSF041F04- CATCAGTGCTTATATTGGTTATGTCTATCAGTACAATTCACTTGATTCTCAACCTGATGT
rJMSF035B19+ CATCAGTGCTTATATNGGTTATGTCTATCAGTACAATTCACTTGATTCTCAACCTGATGT
rJMSF041F04+ CATCAGTGCTTATATTGGTTATGTCTATCAGTACAATTCACTTGATTCTCAACCTGATGT
                      ____________________________________________________________
consensus CATCAGTGCTTATATTGGTTATGTCTATCAGTACAATTCACTTGATTCTCAACCTGATGT
 
. : . : . : . : . : . :
JMSF020J16- TCTAAAATCACTTTATTCTCCTCTTCAACCGTCTAGTTCTTTGGAAGGNTTGAGGTA
JMSF035B19- TCTAAAATCACTTTATTCTCCTCTTCAACCGTCTAGTTCTTTGGAAGGTTTGAGGTATCA
JMSF041F04- TCTAAAATCACTTTATTCTCCTCTTCAACCGTCTAGTTCTTTGGAAGGTTTGAGGTATCA
rJMSF035B19+ TCTAAAATCACTTTATTCTCCTCTTCAACCGTCTAGTTCTTTGGAAGGTTTGAGGTATCA
rJMSF041F04+ TCTAAAATCACTTTATTCTCCTCTTCAACCGTCTAGTTCTTTGGAAGGTTTGAGGTATCA
rJMSF020J16+ AGGTATCA
                      ____________________________________________________________
consensus TCTAAAATCACTTTATTCTCCTCTTCAACCGTCTAGTTCTTTGGAAGGTTTGAGGTATCA
 
. : . : . : . : . : . :
JMSF035B19- TGATGGGGGTCGACTTTCTGATCAGCAAATGGCTCTATTGCAATATCAACAAGAAAATAT
JMSF041F04- TGATGGGGGTCGACTTTCTGATCAGCAAATGGCTCTATTGCAATATCAACAAGAAAATAT
rJMSF035B19+ TGATGGGGGTCGACTTTCTGATCAGCAAATGGCTCTATTGCAATATCAACAAGAAAATAT
rJMSF041F04+ TGATGGGGGTCGACTTTCTGATCAGCAAATGGCTCTATTGCAATATCAACAAGAAAATAT
rJMSF020J16+ TGATGGGGGTCGACTTTCTGATCAGCAAATGGCTCTATTGCAATATCAACAAGAAAATAT
                      ____________________________________________________________
consensus TGATGGGGGTCGACTTTCTGATCAGCAAATGGCTCTATTGCAATATCAACAAGAAAATAT
 
. : . : . : . : . : . :
JMSF035B19- TCACTTTCTGAATG
JMSF041F04- TCACTTTCTGAATGAGG
rJMSF035B19+ TCACTTTCTGAATGAGGAGATTCTTAGATTGCAAGAATGCTTAAGCAAATATGAAGGATC
rJMSF041F04+ TCACTTTCTGAATGAGGAGATTCTTAGATTGCAAGAATGCTTAAGCAAATATGAAGGATC
rJMSF020J16+ TCACTTTCTGAATGAGGAGATTCTTAGATTGCAAGAATGCTTAAGCAAATATGAAGGATC
                      ____________________________________________________________
consensus TCACTTTCTGAATGAGGAGATTCTTAGATTGCAAGAATGCTTAAGCAAATATGAAGGATC
 
. : . : . : . : . : . :
rJMSF035B19+ TAATGATGGGAGTGCACCTCAGGTTGATCTTGCTCATCTATTGGCAACTAGGGATCAGGA
rJMSF041F04+ TAATGATGGGAGTGCACCTCAGGTTGATCTTGCTCATCTATTGGCAACTAGGGATCAAGA
rJMSF020J16+ TAATGATGGGAGTGCACCTCAGGTTGATCTTGCTCATCTATTGGCAACTAGGGATCAGGA
                      ____________________________________________________________
consensus TAATGATGGGAGTGCACCTCAGGTTGATCTTGCTCATCTATTGGCAACTAGGGATCAGGA
 
. : . : . : . : . : . :
rJMSF035B19+ GTTGCGTACAGTTTCAGCTGAGATGAATCAAATGCAATCTGAGCTAATACTTGCTCGATC
rJMSF041F04+ GTTGCGTACAGTTTCAGCTGAGATGAATCAAATGCAATCTGAGCTAATACTTGCTCGATC
rJMSF020J16+ GTTGCGTACAGTTTCAGCTGAGATGAATCAAATGCAATCTGAGCTAATACTTGCTCGATC
                      ____________________________________________________________
consensus GTTGCGTACAGTTTCAGCTGAGATGAATCAAATGCAATCTGAGCTAATACTTGCTCGATC
 
. : . : . : . : . : . :
rJMSF035B19+ TCTGATTGCCGAGAAGGATGCTGAGATTCAACGTGTACGTAATACGAACAATCAGTATGT
rJMSF041F04+ TCTGATTGCCGAGAAGGATGCTGAGATTCAACGTGTACGTAATACGAACAATCAGTATGT
rJMSF020J16+ TCTGATTGCCGAGAAGGATGCTGAGATTCAACGTGTACGTAATACGAACAATCAGTATGT
                      ____________________________________________________________
consensus TCTGATTGCCGAGAAGGATGCTGAGATTCAACGTGTACGTAATACGAACAATCAGTATGT
 
. : . : . : . : . : . :
rJMSF035B19+ GGAGGAAAATGAAAGGCTTAGAGCTATTTTGGGGGAATGGAGTAGCCGGGCAGCCAAACT
rJMSF041F04+ GGAGGAAAATGAAAGGCTTAGAGCTATTTTGGGGGAATGGAGTAGCCGGGCAGCCAAACT
rJMSF020J16+ GGAGGAAAATGAAAGGCTTAGAGCTATTTTGGGGGAATGGAGTAGCCGGGCAGCCAAACT
                      ____________________________________________________________
consensus GGAGGAAAATGAAAGGCTTAGAGCTATTTTGGGGGAATGGAGTAGCCGGGCAGCCAAACT
 
. : . : . : . : . : . :
rJMSF035B19+ TGAGCGTGCATTAGAGGCAGAAAGGATGTCGAACTTCGAATTGCAAAAGAAAGTTAGACT
rJMSF041F04+ TGAGCGTGCATTAGAGGCAGAAAGGATGTCGAACTTCGAATTGCAAAAGAAAGTTAGACT
rJMSF020J16+ TGAGCGTGCATTAGAGGCAGAAAGGATGTCGAACTTCGAATTGCAAAAGAAAGTTAGACT
                      ____________________________________________________________
consensus TGAGCGTGCATTAGAGGCAGAAAGGATGTCGAACTTCGAATTGCAAAAGAAAGTTAGACT
 
. : . : . : . : . : . :
rJMSF035B19+ CTAAGAAGCCAAAGTCCAAACACGTGAAGGAATGTAGCAATCATAGCTTGTGTTCATACC
rJMSF041F04+ CTAAGAAGCCAAAGTCCAAACACGTGAAGGAATGTAGCAATCATAGCTTGTGTTCATACC
rJMSF020J16+ CTAAGAAGCCAAAGTCCAAACACGTGAAGGAATGTAGCAATCATAGCTTGTGTTCATACC
                      ____________________________________________________________
consensus CTAAGAAGCCAAAGTCCAAACACGTGAAGGAATGTAGCAATCATAGCTTGTGTTCATACC
 
. : . : . : . : . : . :
rJMSF035B19+ ATCTTGAATTCCAGTAATGATATGTTGCTTTTGATTCTTTGTATTCTTTTCATCTTCACA
rJMSF041F04+ ATCTTGAATTCCAGTAATGATATGTTGCTTTTGATTCTTTGTATTCTTTTCATCTTCACA
rJMSF020J16+ ATCTTGAATTCCAGTAATGATATGTTGCTTTTGATTCTTTGTATTCTTTTCATCTTCACA
                      ____________________________________________________________
consensus ATCTTGAATTCCAGTAATGATATGTTGCTTTTGATTCTTTGTATTCTTTTCATCTTCACA
 
. : . : . : . : . : . :
rJMSF035B19+ CTTATATCGAACTATGT
rJMSF041F04+ CTTATATCGAACTATGTTATCTGAAAAGATGATCG
rJMSF020J16+ CTTATATCGAACTATGTTATCTGAAAAGATGATCGTGATCCCACTTCACTGTTGTAGATC
                      ____________________________________________________________
consensus CTTATATCGAACTATGTTATCTGAAAAGATGATCGTGATCCCACTTCACTGTTGTAGATC
 
. : . : . : . : . : . :
rJMSF020J16+ TTGTCTTCAACATAATGTCTTTACGATTCTCTTGAGCCAGGTTCCAGATTCATGCATGGT
                      ____________________________________________________________
consensus TTGTCTTCAACATAATGTCTTTACGATTCTCTTGAGCCAGGTTCCAGATTCATGCATGGT
 
. : . : . : . : . : . :
rJMSF020J16+ ACATGGAATAGCAAGTTCTTAGATTGGAGCAAGTGAGTTTCCGCAAGTTTCTGAAAGGAA
                      ____________________________________________________________
consensus ACATGGAATAGCAAGTTCTTAGATTGGAGCAAGTGAGTTTCCGCAAGTTTCTGAAAGGAA