Previous Contig 012144:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008H18Sequence592000441 (7)pir|T49900|T499003e-382-oxoglutarate/malate translocator-like protein T24H18.30 [similarity] - Arabido757012144 (7)sp|Q41364|SOT1_SPIOL3e-822-oxoglutarate/malate translocator, chloroplast precursor.>gb:A47930_1449453 Seq
JMFF014K14Sequence592000441 (7)pir|T49900|T499003e-382-oxoglutarate/malate translocator-like protein T24H18.30 [similarity] - Arabido668012144 (7)sp|Q41364|SOT1_SPIOL1e-782-oxoglutarate/malate translocator, chloroplast precursor.>gb:A47930_1449453 Seq
JMFF022M02Sequence491000441 (7)pir|T49900|T499003e-192-oxoglutarate/malate translocator-like protein T24H18.30 [similarity] - Arabido544012144 (7)sp|Q41364|SOT1_SPIOL1e-522-oxoglutarate/malate translocator, chloroplast precursor.>gb:A47930_1449453 Seq
JMFF033C03Sequence297000441 (7)606012144 (7)sp|Q41364|SOT1_SPIOL3e-782-oxoglutarate/malate translocator, chloroplast precursor.>gb:A47930_1449453 Seq
JMFF037J19Sequence534000441 (7)pir|T49900|T499004e-262-oxoglutarate/malate translocator-like protein T24H18.30 [similarity] - Arabido733012144 (7)sp|Q41364|SOT1_SPIOL6e-792-oxoglutarate/malate translocator, chloroplast precursor.>gb:A47930_1449453 Seq
JMFF047N03Sequence614000441 (7)pir|T49900|T499002e-422-oxoglutarate/malate translocator-like protein T24H18.30 [similarity] - Arabido602012144 (7)sp|Q41364|SOT1_SPIOL2e-632-oxoglutarate/malate translocator, chloroplast precursor.>gb:A47930_1449453 Seq
JMSF020J10Sequence688000441 (7)pir|T49900|T499002e-512-oxoglutarate/malate translocator-like protein T24H18.30 [similarity] - Arabido757012144 (7)sp|Q41364|SOT1_SPIOL1e-782-oxoglutarate/malate translocator, chloroplast precursor.>gb:A47930_1449453 Seq

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF037J19+ TGGGTTTTTGGCAGCGTGTTAAATATAGACGCTG
rJMFF008H18+ CTCTGCTTATTACGGTGGGTCTTTGGGTTTTTGGCAGCGTGTTAAATATAGACGCTG
rJMSF020J10+ TGGGTTTTNGGCAGCGTGTTAAATATAGACGCTG
                      ____________________________________________________________
consensus CTCTGCTTATTACGGTGGGTCTTTGGGTTTTTGGCAGCGTGTTAAATATAGACGCTG
 
. : . : . : . : . : . :
rJMFF037J19+ TTACTGCCGCGATTCTTGGGTTAACTATCCTCCTGGTGACCGGAGTAGTCTCATGGAAGG
rJMFF033C03+ TGACCGGAGTAGTCTCATGGAAGG
rJMFF008H18+ TTACTGCCGCGATTCTTGGGTTAACTATCCTCCTGGTGACCGGAGTAGTCTCATGGAAGG
rJMFF014K14+ GTGACCGGAGTAGTCTCATGGAAGG
rJMSF020J10+ TTACTGCCGCGATTCTTGGGTTAACTATCCTCCTGGTGACCGGAGTAGTCTCATGGAAGG
                      ____________________________________________________________
consensus TTACTGCCGCGATTCTTGGGTTAACTATCCTCCTGGTGACCGGAGTAGTCTCATGGAAGG
 
. : . : . : . : . : . :
rJMFF037J19+ AATGTTTATCCGAAGCAGTTGCTTGGGATACCCTCACTTGGTTCGCGGCGCTCATTGCCA
rJMFF033C03+ AATGTTTATCCGAAGCAGTTGCTTGGGATACCCTCACTTGGTTCGCGGCGCTCATTGCCA
rJMFF008H18+ AATGTTTATCCGAAGCAGTTGCTTGGGATACCCTCACTTGGTTCGCGGCGCTCATTGCCA
rJMFF014K14+ AATGTTTATCCGAAGCAGTTGCTTGGGATACCCTCACTTGGTTCGCGGCGCTCATTGCCA
rJMFF047N03+ CATTGCCA
rJMSF020J10+ AATGTTTATCCGAAGCAGTTGCTTGGGATACCCTCACTTGGTTCGCGGCGCTCATTGCCA
                      ____________________________________________________________
consensus AATGTTTATCCGAAGCAGTTGCTTGGGATACCCTCACTTGGTTCGCGGCGCTCATTGCCA
 
. : . : . : . : . : . :
rJMFF037J19+ TGGCGGGTTATCTAAACAAATATGGCCTAATCTCGTGGTTTAGCGAGACTGTTGTCAAGG
rJMFF033C03+ TGGCGGGTTATCTAAACAAATATGGCCTAATCTCGTGGTTTAGCGAGACTGTTGTCAAGG
rJMFF022M02+ GTTGTCAAGG
rJMFF008H18+ TGGCGGGTTATCTAAACAAATATGGCCTAATCTCGTGGTTTAGCGAGACTGTTGTCAAGG
rJMFF014K14+ TGGCGGGTTATCTAAACAAATATGGCCTAATCTCGTGGTTTAGCGAGACTGTTGTCAAGG
rJMFF047N03+ TGGCGGGTTATCTAAACAAATATGGCCTAATCTCGTGGTTTAGCGAGACTGTTGTCAAGG
rJMSF020J10+ TGGCGGGTTATCTAAACAAATATGGCCTAATCTCGTGGTTTAGCGAGACTGTTGTCAAGG
                      ____________________________________________________________
consensus TGGCGGGTTATCTAAACAAATATGGCCTAATCTCGTGGTTTAGCGAGACTGTTGTCAAGG
 
. : . : . : . : . : . :
rJMFF037J19+ TTGTTGGTGGATTAGGCCTATCATGGCAGCTATCGTTCGGGATCCTAGTTCTCCTCTACT
rJMFF033C03+ TTGTTGGTGGATTAGGCCTATCATGGCAGCTATCGTTCGGGATCCTAGTTCTCCTCTACT
rJMFF022M02+ TTGTTGGTGGATTAGGCCTATCATGGCAGCTATCGTTCGGGATCCTAGTTCTCCTCTACT
rJMFF008H18+ TTGTTGGTGGATTAGGCCTATCATGGCAGCTATCGTTCGGGATCCTAGTTCTCCTCTACT
rJMFF014K14+ TTGTTGGTGGATTAGGCCTATCATGGCAGCTATCGTTCGGGATCCTAGTTCTCCTCTACT
rJMFF047N03+ TTGTTGGTGGATTAGGCCTATCATGGCAGCTATCGTTCGGGATCCTAGTTCTCCTCTACT
rJMSF020J10+ TTGTTGGTGGATTAGGCCTATCATGGCAGCTATCGTTCGGGATCCTAGTTCTCCTCTACT
                      ____________________________________________________________
consensus TTGTTGGTGGATTAGGCCTATCATGGCAGCTATCGTTCGGGATCCTAGTTCTCCTCTACT
 
. : . : . : . : . : . :
rJMFF037J19+ TCTACTCCCACTACTTCTTTGCGAGCGGGGCTGCTCACATTGGGGCCATGTTTACCGCAT
rJMFF033C03+ TCTACTCCCACTACTTCTTTGCGAGCGGGGCTGCTCACATTGGGGCCATGTTTACCGCAT
rJMFF022M02+ TCTACTCCCACTACTTCTTTGCGAGCGGGGCTGCTCACATTGGGGCCATGTTTACCGCAT
rJMFF008H18+ TCTACTCCCACTACTTCTTTGCGAGCGGGGCTGCTCACATTGGGGCCATGTTTACCGCAT
rJMFF014K14+ TCTACTCCCACTACTTCTTTGCGAGCGGGGCTGCTCACATTGGGGCCATGTTTACCGCAT
rJMFF047N03+ TCTACTCCCACTACTTCTTTGCGAGCGGGGCTGCTCACATTGGGGCCATGTTTACCGCAT
rJMSF020J10+ TCTACTCCCACTACTTCTTTGCGAGCGGGGCTGCTCACATTGGGGCCATGTTTACCGCAT
                      ____________________________________________________________
consensus TCTACTCCCACTACTTCTTTGCGAGCGGGGCTGCTCACATTGGGGCCATGTTTACCGCAT
 
. : . : . : . : . : . :
rJMFF037J19+ TCTTATCTGTCGCTAGTGCTCTTGGCACGCCCCCGTACTTGGGAGCCCTGGTGTTGTCGT
rJMFF033C03+ TCTTATCTGTCGCTAGTGCTCTTGGCACGCCCCCGTACTTGGGAGCCCTGGTGTTGTCGT
rJMFF022M02+ TCTTATCTGTCGCTAGTGCTCTTGGCACGCCCCCGTACTTGGGAGCCCTGGTGTTGTCGT
rJMFF008H18+ TCTTATCTGTCGCTAGTGCTCTTGGCACGCCCCCGTACTTGGGAGCCCTGGTGTTGTCGT
rJMFF014K14+ TCTTATCTGTCGCTAGTGCTCTTGGCACGCCCCCGTACTTGGGAGCCCTGGTGTTGTCGT
rJMFF047N03+ TCTTATCTGTCGCTAGTGCTCTTGGCACGCCCCCGTACTTGGGAGCCCTGGTGTTGTCGT
rJMSF020J10+ TCTTATCTGTCGCTAGTGCTCTTGGCACGCCCCCGTACTTGGGAGCCCTGGTGTTGTCGT
                      ____________________________________________________________
consensus TCTTATCTGTCGCTAGTGCTCTTGGCACGCCCCCGTACTTGGGAGCCCTGGTGTTGTCGT
 
. : . : . : . : . : . :
rJMFF037J19+ TCCTCTCGAACATCATGGGCGGCCTCACCCACTATGGGATCGGATCCGCGCCCGTGTTTT
rJMFF033C03+ TCCTCTCGAACATCATGGGCGGCCTCACCCACTATGGGATCGGATCCGCGCCCGTGTTTT
rJMFF022M02+ TCCTCTCGAACATCATGGGCGGCCTCACCCACTATGGGATCGGATCCGCGCCCGTGTTTT
rJMFF008H18+ TCCTCTCGAACATCATGGGCGGCCTCACCCACTATGGGATCGGATCCGCGCCCGTGTTTT
rJMFF014K14+ TCCTCTCGAACATCATGGGCGGCCTCACCCACTATGGGATCGGATCCGCGCCCGTGTTTT
rJMFF047N03+ TCCTCTCGAACATCATGGGCGGCCTCACCCACTATGGGATCGGATCCGCGCCCGTGTTTT
rJMSF020J10+ TCCTCTCGAACATCATGGGCGGCCTCACCCACTATGGGATCGGATCCGCGCCCGTGTTTT
                      ____________________________________________________________
consensus TCCTCTCGAACATCATGGGCGGCCTCACCCACTATGGGATCGGATCCGCGCCCGTGTTTT
 
. : . : . : . : . : . :
rJMFF037J19+ ATGGCGCGAACTATGTCCCACTTGCCAAATGGTGGGGGTATGGGTTTTTAGTCTCTGTGG
rJMFF033C03+ ATGGCGCGAACTATGTCCCACTTGCCAAATGGTGGGGGTATGGGTTTTTAGTCTCTGTGG
rJMFF022M02+ ATGGCGCGAACTATGTCCCACTTGCCAAATGGTGGGGGTATGGGTTTTTAGTCTCTGTGG
rJMFF008H18+ ATGGCGCGAACTATGTCCCACTTGCCAAATGGTGGGGGTATGGGTTTTTAGTCTCTGTGG
rJMFF014K14+ ATGGCGCGAACTATGTCCCACTTGCCAAATGGTGGGGGTATGGGTTTTTAGTCTCTGTGG
rJMFF047N03+ ATGGCGCGAACTATGTCCCACTTGCCAAATGGTGGGGGTATGGGTTTTTAGTCTCTGTGG
rJMSF020J10+ ATGGCGCGAACTATGTCCCACTTGCCAAATGGTGGGGGTATGGGTTTTTAGTCTCTGTGG
                      ____________________________________________________________
consensus ATGGCGCGAACTATGTCCCACTTGCCAAATGGTGGGGGTATGGGTTTTTAGTCTCTGTGG
 
. : . : . : . : . : . :
rJMFF037J19+ TTAATATTATCATTTGGCTTGGAGTTGGAGGGATTTGGTGGAAAGCCATTGGGTTGTGGT
rJMFF033C03+ TTAATATTATCATTTGGCTTGGAGTTGGAGGGATTTGGTGGAAAGCCATTGGGTTGTGGT
rJMFF022M02+ TTAATATTATCATTTGGCTTGGAGTTGGAGGGATTTGGTGGAAAGCCATTGGGTTGTGGT
rJMFF008H18+ TTAATATTATCATTTGGCTTGGAGTTGGAGGGATTTGGTGGAAAGCCATTGGGTTGTGGT
rJMFF014K14+ TTAATATTATCATTTGGCTTGGAGTTGGAGGGATTTGGTGGAAAGCCATTGGGTTGTGGT
rJMFF047N03+ TTAATATTATCATTTGGCTTGGAGTTGGAGGGATTTGGTGGAAAGCCATTGGGTTGTGGT
rJMSF020J10+ TTAATATTATCATTTGGCTTGGAGTTGGAGGGATTTGGTGGAAAGCCATTGGGTTGTGGT
                      ____________________________________________________________
consensus TTAATATTATCATTTGGCTTGGAGTTGGAGGGATTTGGTGGAAAGCCATTGGGTTGTGGT
 
. : . : . : . : . : . :
rJMFF037J19+ GATTGCTTCTTTAGATGGGCAAGTAGTTTTGTATTCTTTGCCTTGAAAGGTTGAGTTTTT
rJMFF033C03+ GATTGCTTCTTTAGATGGGCAAGTAGTTTTGTATTCTTTGCCTTGAAAGGTTGAGTTTTT
rJMFF022M02+ GATTGCTTCTTTAGATGGGCAAGTAGTTTCGTATTCTTTGCCTTGAAAGGTTGAGTTTTT
rJMFF008H18+ GATTGCTTCTTTAGATGGGCAAGTAGTTTTGTATTCTTTGCCTTGAAAGGTTGAGTTTTT
rJMFF014K14+ GATTGCTTCTTTAGATGGGCAAGTAGTTTTGTATTCTTTGCCTTGAAAGGTTGAGTTTTT
rJMFF047N03+ GATTGCTTCTTTAGATGGGCAAGTAGTTTTGTATTCTTTGCCTTGAAAGGTTGAGTTTTT
rJMSF020J10+ GATTGCTTCTTTAGATGGGCAAGTAGTTTTGTATTCTTTGCCTTGAAAGGTTGAGTTTTT
                      ____________________________________________________________
consensus GATTGCTTCTTTAGATGGGCAAGTAGTTTTGTATTCTTTGCCTTGAAAGGTTGAGTTTTT
 
. : . : . : . : . : . :
rJMFF037J19+ AGTGGGGAGAGATGTAGTGGATGATGCTTTTTGCACATAGTTGGGGTTGTTTATACTTGG
rJMFF033C03+ AGTGGGGAGAGATGTAGTGGATGATGCTTTTTGCACATAG
rJMFF022M02+ AGTGGGGAGAGATGTAGTGGATGATGCTTTTTGCACATAGTTGGGGTTGTTTATACTTGG
rJMFF008H18+ AGTGGGGAGAGATGTAGTGGATGATGCTTTTTGCACATAGTTGGGGTTGTTTATACTTGG
rJMFF014K14+ AGTGGGGAGAGATGTAGTGGATGATGCTTTTTGCACATAGTTGGGGTTGTTTATACTTGG
rJMFF047N03+ AGTGGGGAGAGATGTAGTGGATGATGCTTTTTGCACATAGTTGGGGTTGTTTATACTTGG
rJMSF020J10+ AGTGGGGAGAGATGTAGTGGATGATGCTTTTTGCACATAGTTGGGGTTGTTTATACTTGG
                      ____________________________________________________________
consensus AGTGGGGAGAGATGTAGTGGATGATGCTTTTTGCACATAGTTGGGGTTGTTTATACTTGG
 
. : . : . : . : . : . :
rJMFF037J19+ AAGTTCAGATTTGTATGCAGAATTATTTATACAAAAAGA
rJMFF022M02+ AAGTTCAGATTTGTATGCAGAATTA-TTATACAAAAAGA
rJMFF008H18+ AAGTTCAGATTTGTATGCAGAATTATTTATACAAAAAGAA
rJMFF014K14+ AAGTTCAGATTTGTATGCAGAATTATTTATACAAAAAGAA
rJMFF047N03+ AAGTTCAGATTTGTATGCAGAATTATTTATACAAAAAGAAACTTCAAGTTGTAC
rJMSF020J10+ AAGTTCAGATTTGTATGCAGAATTATTTATACAAAAAGAAACTTCAAGTTGTACATTTTT
                      ____________________________________________________________
consensus AAGTTCAGATTTGTATGCAGAATTATTTATACAAAAAGAAACTTCAAGTTGTACATTTTT