Previous Contig 012139:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF020I06Sequence262003144 (4)747012139 (2)gb:AP005589_18545813e-38Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P052
JMSF030M02Sequence248003144 (4)682012139 (2)gb:AP005589_18545812e-27Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P052

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF020I06+ CTCCGGGAACCGAGCCACGCTATTCAAC
                      ____________________________________________________________
consensus CTCCGGGAACCGAGCCACGCTATTCAAC
 
. : . : . : . : . : . :
rJMSF030M02+ CAGAATCACCCGTTGTGAGCNTTGCTGCCAGGGAT
rJMSF020I06+ GTCGTGGGGCAGCCACTTAGATTTCCAGAATCACCCGTTGTGAGCTTTGCTGCCAGGGAT
                      ____________________________________________________________
consensus GTCGTGGGGCAGCCACTTAGATTTCCAGAATCACCCGTTGTGAGCTTTGCTGCCAGGGAT
 
. : . : . : . : . : . :
rJMSF030M02+ CTCATACGCGGGCTGCTCATTAAAGAACCACAGAACCGATTGGCTTATAAAAAGGGAGCC
rJMSF020I06+ CTCATACGCGGGCTGCTCATTAAAGAACCACAGAACCGATTGGCTTATAAAAAGGGAGCC
                      ____________________________________________________________
consensus CTCATACGCGGGCTGCTCATTAAAGAACCACAGAACCGATTGGCTTATAAAAAGGGAGCC
 
. : . : . : . : . : . :
rJMSF030M02+ ACTGAAATAAAGCAGCACCCTTTCTTCGAAGGAGTGAACTGGGCGTTGATACGCTGCGCT
rJMSF020I06+ ACTGAAATAAAGCAGCACCCTTTCTTCGAAGGAGTGAACTGGGCGTTGATACGCTGCGCT
                      ____________________________________________________________
consensus ACTGAAATAAAGCAGCACCCTTTCTTCGAAGGAGTGAACTGGGCGTTGATACGCTGCGCT
 
. : . : . : . : . : . :
rJMSF030M02+ ACGCCCCCCGAGGTCCCAAAGCCAGTCGAATTCGAGAAATTGCCTGTTCCAGCAGCATCA
rJMSF020I06+ ACGCCCCCCGAGGTCCCAAAGCCAGTCGAATTCGAGAAATTGCCTGTTCCAGCAGCATCA
                      ____________________________________________________________
consensus ACGCCCCCCGAGGTCCCAAAGCCAGTCGAATTCGAGAAATTGCCTGTTCCAGCAGCATCA
 
. : . : . : . : . : . :
rJMSF030M02+ ACAAGCGAAAAAGCGACTCCTGTCGCAGTGGCCCCCAATCAGAAAGGCTCTGATAATTAC
rJMSF020I06+ ACAAGCGAAAAAGCGACTCCTGTCGCAGTGGCCCCCAATCAGAAAGGCTCTGATAATTAC
                      ____________________________________________________________
consensus ACAAGCGAAAAAGCGACTCCTGTCGCAGTGGCCCCCAATCAGAAAGGCTCTGATAATTAC
 
. : . : . : . : . : . :
rJMSF030M02+ CTGGAGTTTGATTTCTTCTAGAAAATATTGCTAGTATAATTGGAATGTGTTTGCTCTATG
rJMSF020I06+ CTGGAGTTTGATTTCTTCTAGAAAATATTGCTAGTATAATTGGAATGTGTTTGCTCTATG
                      ____________________________________________________________
consensus CTGGAGTTTGATTTCTTCTAGAAAATATTGCTAGTATAATTGGAATGTGTTTGCTCTATG
 
. : . : . : . : . : . :
rJMSF030M02+ GAGAAGATACTTTTAAATTCATTCTGAATATTTGGCATTTTAGTAATCTTGATGGCAGAT
rJMSF020I06+ GAGAAGATACTTTTAAATTCATTCTGAATATTTGGCATTTTAGTAATCTTGATGGCAGAT
                      ____________________________________________________________
consensus GAGAAGATACTTTTAAATTCATTCTGAATATTTGGCATTTTAGTAATCTTGATGGCAGAT
 
. : . : . : . : . : . :
rJMSF030M02+ TTCTTTCCTCATAATAGCAATCTTTTTCAACCTCTTCCATGACAGCTCTATCTCCCAGGA
rJMSF020I06+ TTCTTTCCTCATAATAGCAATCTTTTTCAACCTCTTCCATGACAGCTCTATCTCCCAGGA
                      ____________________________________________________________
consensus TTCTTTCCTCATAATAGCAATCTTTTTCAACCTCTTCCATGACAGCTCTATCTCCCAGGA
 
. : . : . : . : . : . :
rJMSF030M02+ AACCCGAGGAATTTTTCCGAGCTGATTTGCAGAAACACACGATTTGGGTCGAAACATGAC
rJMSF020I06+ AACCCGAGGAATTTTTCCGAGCTGATTTGCAGAAACACACGATTTGGGTCGAAACATGAC
                      ____________________________________________________________
consensus AACCCGAGGAATTTTTCCGAGCTGATTTGCAGAAACACACGATTTGGGTCGAAACATGAC
 
. : . : . : . : . : . :
rJMSF030M02+ AGCAGATCAGCCGCCTTATACAAGATCACTCTGTATATTTCTTTTTTTTTATTTTTTTGA
rJMSF020I06+ AGCAGATCAGCCGCCTTATACAAGATCACTCTGTATATTTCTTTTTTTTTATTTTTTTGA
                      ____________________________________________________________
consensus AGCAGATCAGCCGCCTTATACAAGATCACTCTGTATATTTCTTTTTTTTTATTTTTTTGA
 
. : . : . : . : . : . :
rJMSF030M02+ TAATTCCTAGGATATGTTCCACATTCGAAGGTACATTAGTAGGACCCAATGTAGATGTGC
rJMSF020I06+ TAATTCCTAGGATATGTTCCACATTCGAAGGTACATTAGTAGGACCCAATGTAGATGTGC
                      ____________________________________________________________
consensus TAATTCCTAGGATATGTTCCACATTCGAAGGTACATTAGTAGGACCCAATGTAGATGTGC
 
. : . : . : . : . : . :
rJMSF030M02+ TCCCCCACCTTTGAGATCTACCATGCTTTTTGAATGTTGGTGTATTA
rJMSF020I06+ TCCCCCACCTTTGAGATCT-CCATGCTTTTTGAATGTTGGTGTATTATCTGACACTGAAC
                      ____________________________________________________________
consensus TCCCCCACCTTTGAGATCTACCATGCTTTTTGAATGTTGGTGTATTATCTGACACTGAAC