Previous Contig 012138:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF020I05Sequence686012138 (4)gb:STU318070_17230614e-64Solanum tuberosum mRNA for ferredoxin-thioredoxin-reductase catalytic subunit B 776012138 (4)gb:STU318070_17230614e-64Solanum tuberosum mRNA for ferredoxin-thioredoxin-reductase catalytic subunit B
JMSF025E15Sequence674012138 (4)gb:STU318070_17230613e-59Solanum tuberosum mRNA for ferredoxin-thioredoxin-reductase catalytic subunit B 773012138 (4)gb:STU318070_17230611e-63Solanum tuberosum mRNA for ferredoxin-thioredoxin-reductase catalytic subunit B

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF025E15- GATTCTTCTCCGACCCGATA
                      ____________________________________________________________
consensus GATTCTTCTCCGACCCGATA
 
. : . : . : . : . : . :
JMSF025E15- TTTCAACGTGTGGCGCCCACGCTTCTGAAGATCATTTTCCATCTGAAATCTGTTTCCTCC
rJMSF025E15+ CTGAAGATCATTTTCCATCTGAAATCTGTTTCCTCC
                      ____________________________________________________________
consensus TTTCAACGTGTGGCGCCCACGCTTCTGAAGATCATTTTCCATCTGAAATCTGTTTCCTCC
 
. : . : . : . : . : . :
JMSF025E15- AATCCCGATTTTTCCGGTTCGCGGCATCTGAGTGTATTTAATAACTAGAAGTTATGCATT
rJMSF025E15+ AATCCCGATTTTTCCGGTTCGCGGCATCTGAGTGTATTTAATAACTAGAAGTTATGCATT
                      ____________________________________________________________
consensus AATCCCGATTTTTCCGGTTCGCGGCATCTGAGTGTATTTAATAACTAGAAGTTATGCATT
 
. : . : . : . : . : . :
JMSF025E15- TCAACGAAGACGACTATTGAGCAACTGCAATACTTACCACAGATATTTCTCTGTTCAACT
rJMSF025E15+ TCAACGAAGACGACTATTGAGCAACTGCAATACTTACCACAGATATTTCTCTGTTCAACT
JMSF020I05- GAAGACGACTATTGAGCAACTGCAATACTTACCACAGATATTTCTCTGTTCAACT
rJMSF020I05+ GAAGACGACTATTGAGCAACTGCAATACTTACCACAGATATTTCTCTGTTCAACT
                      ____________________________________________________________
consensus TCAACGAAGACGACTATTGAGCAACTGCAATACTTACCACAGATATTTCTCTGTTCAACT
 
. : . : . : . : . : . :
JMSF025E15- GTGGCGTAAACCCGCCGTTTCTTAGACATTACTTACCGCCATGAGAGCTCTTCAGGCGTC
rJMSF025E15+ GTGGCGTAAACCCGCCGTTTCTTAGACATTACTTACCGCCATGAGAGCTCTTCAGGCGTC
JMSF020I05- GTGGCGTAAACCCGCCGTTTCTTAGACATTACTTACCGCCATGAGAGCTCTTCAGGCGTC
rJMSF020I05+ GTGGCGTAAACCCGCCGTTTCTTAGACATTACTTACCGCCATGAGAGCTCTTCAGGCGTC
                      ____________________________________________________________
consensus GTGGCGTAAACCCGCCGTTTCTTAGACATTACTTACCGCCATGAGAGCTCTTCAGGCGTC
 
. : . : . : . : . : . :
JMSF025E15- GATTCCCTACAATCTTGGATTTGGCATTCCCTCCCTTGCTGCTACTCCCAGTAGCCGGCC
rJMSF025E15+ GATTCCCTACAATCTTGGATTTGGCATTCCCTCCCTTGCTGCTACTCCCAGTAGCCGGCC
JMSF020I05- GATTCCCTACAATCTTGGATTTGGCATTCCCTCCCTTGCTGCTACTCCCAGTAGCCGGCC
rJMSF020I05+ GATTCCCTACAATCTTGGATTTGGCATTCCCTCCCTTGCTGCTACTCCCAGTAGCCGGCC
                      ____________________________________________________________
consensus GATTCCCTACAATCTTGGATTTGGCATTCCCTCCCTTGCTGCTACTCCCAGTAGCCGGCC
 
. : . : . : . : . : . :
JMSF025E15- TTCTTACGCTCAGCGCCGCCATGTCGTATTCGCTAAAGTTGAACGTGAACCATCTGAGCA
rJMSF025E15+ TTCTTACGCTCAGCGCCGCCATGTCGTATTCGCTAAAGTTGAACGTGAACCATCTGAGCA
JMSF020I05- TTCTTACGCTCAGCGCCGCCATGTCGTATTCGCTAAAGTTGAACGTGAACCATCTGAGCA
rJMSF020I05+ TTCTTACGCTCAGCGCCGCCATGTCGTATTCGCTAAAGTTGAACGTGAACCATCTGAGCA
                      ____________________________________________________________
consensus TTCTTACGCTCAGCGCCGCCATGTCGTATTCGCTAAAGTTGAACGTGAACCATCTGAGCA
 
. : . : . : . : . : . :
JMSF025E15- ATCTATTGAGATAATGAGGAAGTTCTCAGAGCAGTACGCTCGGAAGTCTGGAACCTACTT
rJMSF025E15+ ATCTATTGAGATAATGAGGAAGTTCTCAGAGCAGTACGCTCGGAAGTCTGGAACCTACTT
JMSF020I05- ATCTATTGAGATAATGAGGAAGTTCTCAGAGCAGTACGCTCGGAGGTCTGGAACCTACTT
rJMSF020I05+ ATCTATTGAGATAATGAGGAAGTTCTCAGAGCAGTACGCTCGGAGGTCTGGAACCTACTT
                      ____________________________________________________________
consensus ATCTATTGAGATAATGAGGAAGTTCTCAGAGCAGTACGCTCGGAGGTCTGGAACCTACTT
 
. : . : . : . : . : . :
JMSF025E15- CTGTATGGACAAAGGGGTCACTGCTGTTGTCATTAAGGGACTGGCCGAACACAAGGATTC
rJMSF025E15+ CTGTATGGACAAAGGGGTCACTGCTGTTGTCATTAAGGGACTGGCCGAACACAAGGATTC
JMSF020I05- CTGTATGGACAAAGGGGTCACTGCTGTTGTCATTAAGGGACTGGCCGAACACAAGGATTC
rJMSF020I05+ CTGTATGGACAAAGGGGTCACTGCTGTTGTCATTAAGGGACTGGCCGAACACAAGGATTC
                      ____________________________________________________________
consensus CTGTATGGACAAAGGGGTCACTGCTGTTGTCATTAAGGGACTGGCCGAACACAAGGATTC
 
. : . : . : . : . : . :
JMSF025E15- ATTGGGTGCACCGCTCTGTCCCTGTAGGCACTATGATGATAAACCTGCAGAAGCGCAACA
rJMSF025E15+ ATTGGGTGCACCGCTCTGTCCCTGTAGGCACTATGATGATAAACCTGCAGAAGCGCAACA
JMSF020I05- ATTGGGTGCACCGCTCTGTCCCTGTAGGCACTATGATGATAAACCTGCAGAAGCGCAACA
rJMSF020I05+ ATTGGGTGCACCGCTCTGTCCCTGTAGGCACTATGATGATAAACCTGCAGAAGCGCAACA
                      ____________________________________________________________
consensus ATTGGGTGCACCGCTCTGTCCCTGTAGGCACTATGATGATAAACCTGCAGAAGCGCAACA
 
. : . : . : . : . : . :
JMSF025E15- GGGTTTCTGGAACTGCCCCTGTGTACCTATGAGAGAGAGGAAGGAGTGTCACTGCATGCT
rJMSF025E15+ GGGTTTCTGGAACTGCCCCTGTGTACCTATGAGAGAGAGGAAGGAGTGTCACTGCATGCT
JMSF020I05- GGGTTTCTGGAACTGCCCCTGTGTACCTATGAGAGAGAGGAAGGAGTGTCACTGCATGCT
rJMSF020I05+ GGGTTTCTGGAACTGCCCCTGTGTACCTATGAGAGAGAGGAAGGAGTGTCACTGCATGCT
                      ____________________________________________________________
consensus GGGTTTCTGGAACTGCCCCTGTGTACCTATGAGAGAGAGGAAGGAGTGTCACTGCATGCT
 
. : . : . : . : . : . :
JMSF025E15- CTTTCTCACCCCTGATAATGACTTTGCTGGGCAAGATCAGACTATTTCTTTGGA
rJMSF025E15+ CTTTCTCACCCCTGATAATGACTTTGCTGGGCAAGATCAGACTATTTCTTTGGAAGAGAT
JMSF020I05- CTTTCTCACCCCTGATAATGACTTTGCTGGGCAAGATCAGACTATTTCTTTGGAAGAGAT
rJMSF020I05+ CTTTCTCACCCCTGATAATGACTTTGCTGGGCAAGATCAGACTATTTCTTTGGAAGAGAT
                      ____________________________________________________________
consensus CTTTCTCACCCCTGATAATGACTTTGCTGGGCAAGATCAGACTATTTCTTTGGAAGAGAT
 
. : . : . : . : . : . :
rJMSF025E15+ CAGAGAAACAACTTCAAATTTGTGAT
JMSF020I05- CAGAGAAACAACTTCAAATTTGTGAT
rJMSF020I05+ CAGAGAAACAACTTCAAATTTGTGATGCTTCATCATCTTGTATTCATTCCTTTAAAATGA
                      ____________________________________________________________
consensus CAGAGAAACAACTTCAAATTTGTGATGCTTCATCATCTTGTATTCATTCCTTTAAAATGA
 
. : . : . : . : . : . :
rJMSF020I05+ CCATATGTAGATGTGTATGCTGAGTTGTTAACGACTTTTGTTCATTTCATTGATGTATGT
                      ____________________________________________________________
consensus CCATATGTAGATGTGTATGCTGAGTTGTTAACGACTTTTGTTCATTTCATTGATGTATGT
 
. : . : . : . : . : . :
rJMSF020I05+ GCTGAAGTTGTTAAACGTACACAGGCACAGAAAGGAAAAGAGCAGTTTTGCTTGTTAACA
                      ____________________________________________________________
consensus GCTGAAGTTGTTAAACGTACACAGGCACAGAAAGGAAAAGAGCAGTTTTGCTTGTTAACA
 
. : . : . : . : . : . :
rJMSF020I05+ CATCGTTATTTTTTTCATTTCTCCAACCCAAGCTTTGTACTATAGCTCTGGAAATCACAC
                      ____________________________________________________________
consensus CATCGTTATTTTTTTCATTTCTCCAACCCAAGCTTTGTACTATAGCTCTGGAAATCACAC