Previous Contig 012136:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF017I18Sequence451007402 (4)736012136 (4)gb:BT005292_16382322e-51Arabidopsis thaliana At4g16580 mRNA, complete cds.>gb:AK117940_1815947 Arabidops
JMSF020H21Sequence704007402 (4)740012136 (4)gb:BT005292_16382324e-53Arabidopsis thaliana At4g16580 mRNA, complete cds.>gb:AK117940_1815947 Arabidops
JMSF020O10Sequence670007402 (4)723012136 (4)gb:BT005292_16382324e-53Arabidopsis thaliana At4g16580 mRNA, complete cds.>gb:AK117940_1815947 Arabidops
JMSF041E03Sequence814007402 (4)838012136 (4)pir|E85184|E851846e-57hypothetical protein dl4315c [imported] - Arabidopsis thaliana>gb:ATCHRIV44_1545

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF041E03+ TTGTATCATTGCCCTTACAGATCAGCAGGGTCTCCATGCCATCAATTAGGCGATAGTG
                      ____________________________________________________________
consensus TTGTATCATTGCCCTTACAGATCAGCAGGGTCTCCATGCCATCAATTAGGCGATAGTG
 
. : . : . : . : . : . :
rJMSF041E03+ GATTCATGGTGGTGAGGGATGGATGTACTGTTTCAGATCTCCTTCTCAGCAGCATGATTT
rJMSF020O10+ TCTCAGCAGCATGATTT
rJMSF017I18+ TCTCAGCAGCATGATTT
rJMSF020H21+ TCTCAGCAGCATGATTT
                      ____________________________________________________________
consensus GATTCATGGTGGTGAGGGATGGATGTACTGTTTCAGATCTCCTTCTCAGCAGCATGATTT
 
. : . : . : . : . : . :
rJMSF041E03+ CAATTTCACATATCAATTAGAATGTGGCAACGCTGGTGATCTCCCGAGCTCTGGACAGGT
rJMSF020O10+ CAATTTCACATATCAATTAGAATGTGGCAACGCTGGTGATCTCCCGAGCTCTGGACAGGT
rJMSF017I18+ CAATTTCACATATCAATTAGAATGTGGCAACGCTGGTGATCTCCCGAGCTCTGGACAGGT
rJMSF020H21+ CAATTTCACATATCAATTAGAATGTGGCAACGCTGGTGATCTCCCGAGCTCTGGACAGGT
                      ____________________________________________________________
consensus CAATTTCACATATCAATTAGAATGTGGCAACGCTGGTGATCTCCCGAGCTCTGGACAGGT
 
. : . : . : . : . : . :
rJMSF041E03+ GTTCAAAGTTCCAGTTGCTCGAGGAGATGTCATAATTGCTGGTACAGATGGCCTCTTTGA
rJMSF020O10+ GTTCAAAGTTCCAGTTGCTCGAGGAGATGTCATAATTGCTGGTACAGATGGCCTCTTTGA
rJMSF017I18+ GTTCAAAGTTCCAGNTGCTCGAGGAGATGTCATAATTGCTGGTACAGATGGCCTCTTTGA
rJMSF020H21+ GTTCAAAGTTCCAGTTGCTCGAGGAGATGTCATAATTGCTGGTACAGATGGCCTCTTTGA
                      ____________________________________________________________
consensus GTTCAAAGTTCCAGTTGCTCGAGGAGATGTCATAATTGCTGGTACAGATGGCCTCTTTGA
 
. : . : . : . : . : . :
rJMSF041E03+ CAATCTCTATAACAGCGATATTACTGCAGTTGTGGTTCATGCTACAAGAGCTGGCTTAGG
rJMSF020O10+ CAATCTCTATAACAGCGATATTACTGCAGTTGTGGTTCATGCTACAAGAGCTGGCTTAGG
rJMSF017I18+ CAATCTCTATAACAGCGATATTACTGCAGTTGTGGTTCATGCTACAAGAGCTGGNTTAGG
rJMSF020H21+ CAATCTCTATAACAGCGATATTACTGCAGTTGTGGTTCATGCTACAAGAGCTGGCTTAGG
                      ____________________________________________________________
consensus CAATCTCTATAACAGCGATATTACTGCAGTTGTGGTTCATGCTACAAGAGCTGGCTTAGG
 
. : . : . : . : . : . :
rJMSF041E03+ GCCACAGGTGACTGCTCAGAAGATAGCAGCATTGGCACGTCAGCGAGCACAGGATAAAAA
rJMSF020O10+ GCCACAGGTGACTGCTCAGAAGATAGCAGCATTGGCACGTCAGCGAGCACAGGATAAAAA
rJMSF017I18+ GCCACAGGTGNCTGCTCAGAAGATAGCAGCATTGGCACGTCAGCGAGCACAGGATAAAAA
rJMSF020H21+ GCCACAGGTGACTGCTCAGAAGATAGCAGCATTGGCACGTCAGCGAGCACAGGATAAAAA
                      ____________________________________________________________
consensus GCCACAGGTGACTGCTCAGAAGATAGCAGCATTGGCACGTCAGCGAGCACAGGATAAAAA
 
. : . : . : . : . : . :
rJMSF041E03+ CAGGCAGACACCTTTCTCTACCGCAGCCCAAGAAGCCGGATTTCGTTATTATGGTGGCAA
rJMSF020O10+ CAGGCAGACACCTTTCTCTACCGCAGCCCAAGAAGCCGGATTTCGTTATTATGGTGGCAA
rJMSF017I18+ CAGGCAGACACCTTTCTCTACCGCAGCCCAAGAAGCCGGATTTCGTTATTATGGTGGCAA
rJMSF020H21+ CAGGCAGACACCTTTCTCTACCGCAGCCCAAGAAGCCGGATTTCGTTATTATGGTGGCAA
                      ____________________________________________________________
consensus CAGGCAGACACCTTTCTCTACCGCAGCCCAAGAAGCCGGATTTCGTTATTATGGTGGCAA
 
. : . : . : . : . : . :
rJMSF041E03+ GCTGGATGACATTACCGTAGTAGTTTCTTATATTACCAGCGAGAACAATGAAAACTCGTC
rJMSF020O10+ GCTGGATGACATTACCGTAGTAGTTTCTTATATTACCAGCGAGAACAATGAAAACTCGTC
rJMSF017I18+ GCTGGATGACATTACCGTAGTAGTTTCTTATATTACCAGCGAGAACAATGAAAACTCGTC
rJMSF020H21+ GCTGGATGACATTACCGTAGTAGTTTCTTATATTACCAGCGAGAACAATGAAAACTCGTC
                      ____________________________________________________________
consensus GCTGGATGACATTACCGTAGTAGTTTCTTATATTACCAGCGAGAACAATGAAAACTCGTC
 
. : . : . : . : . : . :
rJMSF041E03+ GGCATCACACAGATCCAGCTAGCAGTTCCCTTCCATCTGATGTGGGAAGCCAATGTTCCT
rJMSF020O10+ GGCATCACACAGATCCAGCTAGCAGTTCCCTTCCATCTGATGTGGGAAGCCAATGTTCCT
rJMSF017I18+ GGCATCACACAGATCCAGCTAGCAGTTCCCTTCCATCTGATGTGGGAAGCCAATGTTCCT
rJMSF020H21+ GGCATCACACAGATCCAGCTAGCAGTTCCCTTCCATCTGATGTGGGAAGCCAATGTTCCT
                      ____________________________________________________________
consensus GGCATCACACAGATCCAGCTAGCAGTTCCCTTCCATCTGATGTGGGAAGCCAATGTTCCT
 
. : . : . : . : . : . :
rJMSF041E03+ TTTTAGCATTAAATCCAACTTTTGCAGTCTTTTTCACAATTCAGCAGCAGTGAAAACTGA
rJMSF020O10+ TTTTAGCATTAAATCCAACTTTTGCAGTCTTTTTCACAATTCAGCAGCAGTGAAAACTGA
rJMSF017I18+ TTTTAGCATTAAATCCAACTTTNGCAGTNTTTTTCACAATTCAGCAGCAGTGAAAACTGA
rJMSF020H21+ TTTTAGCATTAAATCCAACTTTTGCAGTCTTTTTCACAATTCAGCAGCAGTGAAAACTGA
                      ____________________________________________________________
consensus TTTTAGCATTAAATCCAACTTTTGCAGTCTTTTTCACAATTCAGCAGCAGTGAAAACTGA
 
. : . : . : . : . : . :
rJMSF041E03+ AAACCTTAAAAAGTGTCTATATATGTGGGTGCTGATGATGATGAAATTGCAGTCTCTTGT
rJMSF020O10+ AAACCTTAAAAAGTGTCTATATATGTGGGTGCTGATGATGATGAAATTGCAGTCTCTTGT
rJMSF017I18+ AAACCTTAAAAAGTGTCTATATATGTGGGTGCTGATGATGATGAAATTGCAGTCTCTTGT
rJMSF020H21+ AAACCTTAAAAAGTGTCTATATATGTGGGTGCTGATGATGATGAAATTGCAGTCTCTTGT
                      ____________________________________________________________
consensus AAACCTTAAAAAGTGTCTATATATGTGGGTGCTGATGATGATGAAATTGCAGTCTCTTGT
 
. : . : . : . : . : . :
rJMSF041E03+ ACATACACACTAGTTTTGGCAGTCTTTATTCCATTCTTGCCCCTCATTTTGTCTCCCATC
rJMSF020O10+ ACATACACACTAGTTTTGGCAGTCTTTATTCCATTCTTGCCCCTCATTTTGTCTCCCATC
rJMSF017I18+ ACATACACACTAGTTTTGGCAGTCTTTATTCCATTCTTGCCCCTCATTTTGTCTCCCATC
rJMSF020H21+ ACATACACACTAGTTTTGGCAGTCTTTATTCCATTCTTGCCCCTCATTTTGTCTCCCATC
                      ____________________________________________________________
consensus ACATACACACTAGTTTTGGCAGTCTTTATTCCATTCTTGCCCCTCATTTTGTCTCCCATC
 
. : . : . : . : . : . :
rJMSF041E03+ TTCTCCTTTTCTTGGGTAGCAATGGTGGGGGGTAGTATTAGCAAGCAGAATATGTCTTTG
rJMSF020O10+ TTCTCCTTTTCTTGGGTAGCAATGGTGGGGGGTAGTATTAGCAAGCAGAATATGTCTTTG
rJMSF017I18+ TTCTCCTTTTCTTGGGTAGCAATGGTGGGGGGTAGTATTAGCAAGCAGAATANGTCTTTG
rJMSF020H21+ TTCTCCTTTTCTTGGGTAGCAATGGTGGGGGGTAGTATTAGCAAGCAGAATATGTCTTTG
                      ____________________________________________________________
consensus TTCTCCTTTTCTTGGGTAGCAATGGTGGGGGGTAGTATTAGCAAGCAGAATATGTCTTTG
 
. : . : . : . : . : . :
rJMSF041E03+ TTTGATATTTTGTAGTACCAAAGATCAAGAACTGAGAACTTCCATGGTTCCATGCATGA
rJMSF020O10+ TTTGATATTTTGTAGTACCAAAGATCAAGAACTGAGAACTTCC
rJMSF017I18+ TTTGATATTTNGTAGTACCAAAGATCAAGAACTGAGAACTTCCATGGTTCCATGCATGA
rJMSF020H21+ TTTGATATTTTGTAGTACCAAAGATCAAGAACTGAGAACTTCCATGGTTCCATGCATGAT
                      ____________________________________________________________
consensus TTTGATATTTTGTAGTACCAAAGATCAAGAACTGAGAACTTCCATGGTTCCATGCATGAT