Previous Contig 012130:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF020C05Sequence690005895 (2)gb:ATU58942_15571071e-42Arabidopsis thaliana phosphoribosylanthranilate transferase (PAT1) gene, complet764012130 (2)gb:ATU58942_15571077e-72Arabidopsis thaliana phosphoribosylanthranilate transferase (PAT1) gene, complet
JMSF020G14Sequence700005895 (2)gb:ATU58942_15571074e-38Arabidopsis thaliana phosphoribosylanthranilate transferase (PAT1) gene, complet800012130 (2)gb:ATU58942_15571071e-68Arabidopsis thaliana phosphoribosylanthranilate transferase (PAT1) gene, complet

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF020C05+ TGTCTCCTTACTACCATCCGGCTATGAAGATTG
rJMSF020G14+ CCATCCGGCTATGAAGATTG
                      ____________________________________________________________
consensus TGTCTCCTTACTACCATCCGGCTATGAAGATTG
 
. : . : . : . : . : . :
rJMSF020C05+ TTGCACCTGTGAGAAGGAAGCTTAGAATAAAGACCATATTTAACTTCCTGGGCGCTATGT
rJMSF020G14+ TTGCACCTGTGAGNAGGAAGCNTAGAATAAAGACCATATTTAACTTCCTGGGCGCTATGT
                      ____________________________________________________________
consensus TTGCACCTGTGAGAAGGAAGCTTAGAATAAAGACCATATTTAACTTCCTGGGCGCTATGT
 
. : . : . : . : . : . :
rJMSF020C05+ TAAATCCAGCAAGGGTGCCTTTTGCTGTTGTTGGTGTCTACAACGAAAATGTGGTCAGTA
rJMSF020G14+ TAAATCCAGCAAGGGTGCCTTTTGCTGTTGTTGGTGTCTACAACGAAAATGTGGTCAGTA
                      ____________________________________________________________
consensus TAAATCCAGCAAGGGTGCCTTTTGCTGTTGTTGGTGTCTACAACGAAAATGTGGTCAGTA
 
. : . : . : . : . : . :
rJMSF020C05+ AGATGGCCAAAGCCCTACAAAGATATGGCATGAAGAGAGCATTAGTAGTTCATTCAGAGG
rJMSF020G14+ AGATGGCCAAAGCCCTACAAAGATATGGCATGAAGAGAGCATTAGTAGTTCATTCAGAGG
                      ____________________________________________________________
consensus AGATGGCCAAAGCCCTACAAAGATATGGCATGAAGAGAGCATTAGTAGTTCATTCAGAGG
 
. : . : . : . : . : . :
rJMSF020C05+ GCTTAGATGAAATGAGTCCTCTAGGGCCTGGAACTGTCCTTGACATCACACCTGAGAAGA
rJMSF020G14+ GCTTAGATGAAATGAGTCCTCTAGGGCCTGGAACTGTCCTTGACATCACACCTGAGAAGA
                      ____________________________________________________________
consensus GCTTAGATGAAATGAGTCCTCTAGGGCCTGGAACTGTCCTTGACATCACACCTGAGAAGA
 
. : . : . : . : . : . :
rJMSF020C05+ TTGAGAAATTTGCTTTTGATCCGTTGGAATTCGGTATTCCTCGCTGTACGTTAAAGGATC
rJMSF020G14+ TTGAGAAATTTGCTTTTGATCCGTTGGAATTCGGTATTCCTCGCTGTACGTTAAAGGATC
                      ____________________________________________________________
consensus TTGAGAAATTTGCTTTTGATCCGTTGGAATTCGGTATTCCTCGCTGTACGTTAAAGGATC
 
. : . : . : . : . : . :
rJMSF020C05+ TGCAAGGAGCAGGCCCGGAATATAATGCTGATGTTTTAAAACGTGTGCTCTCTGGTGAGA
rJMSF020G14+ TGCAAGGAGCAGGCCCGGAATATAATGCTGATGTTTTAAAACGTGTGCTCTCTGGTGAGA
                      ____________________________________________________________
consensus TGCAAGGAGCAGGCCCGGAATATAATGCTGATGTTTTAAAACGTGTGCTCTCTGGTGAGA
 
. : . : . : . : . : . :
rJMSF020C05+ CTGGACCAATTGCAGATGCATTTATCTTAAACGCTGGTGCTGCATTACTGGTCAGTGGGC
rJMSF020G14+ CTGGACCAATTGCAGATGCATTTATCTTAAACGCTGGTGCTGCATTACTGGTCAGTGGGC
                      ____________________________________________________________
consensus CTGGACCAATTGCAGATGCATTTATCTTAAACGCTGGTGCTGCATTACTGGTCAGTGGGC
 
. : . : . : . : . : . :
rJMSF020C05+ ATGTCAAAACCTTGGCAAAGGGAATAGAACTAGCCCGATGCACACATAGATCAGGGAAAG
rJMSF020G14+ ATGTCAAAACCTTGGCAAAGGGAATAGAACTAGCCCGATGCACACATAGATCAGGGAAAG
                      ____________________________________________________________
consensus ATGTCAAAACCTTGGCAAAGGGAATAGAACTAGCCCGATGCACACATAGATCAGGGAAAG
 
. : . : . : . : . : . :
rJMSF020C05+ CTCTCCATACGCTCAAGTTTTGGATTGATGTCTCAAATAATGTGAAAGAGCCCTAAACAA
rJMSF020G14+ CTCTCCATACGCTCAAGTTTTGGATTGATGTCTCAAATAATGTGAAAGAGCCCTAAACAA
                      ____________________________________________________________
consensus CTCTCCATACGCTCAAGTTTTGGATTGATGTCTCAAATAATGTGAAAGAGCCCTAAACAA
 
. : . : . : . : . : . :
rJMSF020C05+ ATGGTCGCATAGACTGCTGAAGCAAGGATCTGCAACAGCCACAGTTCTGGATGTCAAGAT
rJMSF020G14+ ATGGTCGCATAGACTGCTGAAGCAAGGATCTGCAACAGCCACAGTTCTGGATGTCAAGAT
                      ____________________________________________________________
consensus ATGGTCGCATAGACTGCTGAAGCAAGGATCTGCAACAGCCACAGTTCTGGATGTCAAGAT
 
. : . : . : . : . : . :
rJMSF020C05+ ATGTTCCTTTATGCTCTTTCCATTCCTTCTTCTTTTAACTGCTAGAACTTCAAGAAAACC
rJMSF020G14+ ATGTTCCTTTATGCTCTTTCCATTCCTTCTTCTTTTAACTGCTAGAACTTCAAGAAAACC
                      ____________________________________________________________
consensus ATGTTCCTTTATGCTCTTTCCATTCCTTCTTCTTTTAACTGCTAGAACTTCAAGAAAACC
 
. : . : . : . : . : . :
rJMSF020C05+ TGTGTTATTAGAAGTTTCTCTTTGCTCGTACGAGGTCTAAGCATACTGCCGACTGTGCCA
rJMSF020G14+ TGTGTTATTAGAAGTTTCTCTTTGCTCGTACGAGGTCTAAGCATACTGCCGACTGTGCCA
                      ____________________________________________________________
consensus TGTGTTATTAGAAGTTTCTCTTTGCTCGTACGAGGTCTAAGCATACTGCCGACTGTGCCA
 
. : . : . : . : . : . :
rJMSF020C05+ AGTCTTCTTGG
rJMSF020G14+ AGTCTTCTTGGTGGTCTTTAGGCATCATGACTGAGGAAGGGTGAAAAAAGAGCCCATGTT
                      ____________________________________________________________
consensus AGTCTTCTTGGTGGTCTTTAGGCATCATGACTGAGGAAGGGTGAAAAAAGAGCCCATGTT