Previous Contig 012128:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF020F10Sequence657005887 (4)gb:BT000916_16351712e-49Arabidopsis thaliana clone C105222 unknown protein (At1g06240) mRNA, complete cd750012128 (2)gb:AY742300_11799243e-36Malus x domestica anthranilate N-hydroxycinnamoyl/benzoyltransferase mRNA, parti
JMSF038A20Sequence610012128 (2)gb:AY742300_11799241e-46Malus x domestica anthranilate N-hydroxycinnamoyl/benzoyltransferase mRNA, parti817007731 (14)gb:AY085943_15710054e-70Arabidopsis thaliana clone 19973 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF038A20+ TTCTGCTTGACTACATCCAGAAAGGGAATCTCCACGCC
                      ____________________________________________________________
consensus TTCTGCTTGACTACATCCAGAAAGGGAATCTCCACGCC
 
. : . : . : . : . : . :
JMSF038A20+ ATTACTGGGAGTTCAGGTGACGGAGCTTGATGACGGGTATTTCATCGGCCTCGCCATGAA
                      ____________________________________________________________
consensus ATTACTGGGAGTTCAGGTGACGGAGCTTGATGACGGGTATTTCATCGGCCTCGCCATGAA
 
. : . : . : . : . : . :
JMSF038A20+ TCACACTGCGGCAGACGCTTCGTCTTTCTGGCATTTCTTCAATTCTTGGTCTGAAATCTC
                      ____________________________________________________________
consensus TCACACTGCGGCAGACGCTTCGTCTTTCTGGCATTTCTTCAATTCTTGGTCTGAAATCTC
 
. : . : . : . : . : . :
JMSF038A20+ GCGAGGTATGCCTCAGTTATCTTTACCTCCCGTTCTTGATCCATGGTTTCCAGGCAATAT
                      ____________________________________________________________
consensus GCGAGGTATGCCTCAGTTATCTTTACCTCCCGTTCTTGATCCATGGTTTCCAGGCAATAT
 
. : . : . : . : . : . :
JMSF038A20+ CGCCCGCCCCCTTTGCCTCCCCTTTGATCTCCAGCAAGAAACGTTGTCCAGCTCCTTCAC
                      ____________________________________________________________
consensus CGCCCGCCCCCTTTGCCTCCCCTTTGATCTCCAGCAAGAAACGTTGTCCAGCTCCTTCAC
 
. : . : . : . : . : . :
JMSF038A20+ CCCGCCGCCATTGGAGGAGAGGGTGTTCCATTTCAGCAAAGACACCATTGCAAAGCTCAA
                      ____________________________________________________________
consensus CCCGCCGCCATTGGAGGAGAGGGTGTTCCATTTCAGCAAAGACACCATTGCAAAGCTCAA
 
. : . : . : . : . : . :
JMSF038A20+ GGAAAAAGCCAACTCTGAAATGGGAACCGACTCGATCTCCTCCCTGCAATCATATGTGGC
                      ____________________________________________________________
consensus GGAAAAAGCCAACTCTGAAATGGGAACCGACTCGATCTCCTCCCTGCAATCATATGTGGC
 
. : . : . : . : . : . :
JMSF038A20+ TCACTTGTGGAGGGCCATCACTCGTGCCCGTCGCCTAAACCCCACCGAAGACGTGTCTAT
rJMSF020F10+ TCGCCTAAACCCCACCGAAGACGTGTCTAT
                      ____________________________________________________________
consensus TCACTTGTGGAGGGCCATCACTCGTGCCCGTCGCCTAAACCCCACCGAAGACGTGTCTAT
 
. : . : . : . : . : . :
JMSF038A20+ CTACGTGCCAATAGGCACGAGATGGAGGACGAATCCGCCATTGCCAGAAGGGTATTGGGG
rJMSF020F10+ TTACGTGCCAATAGGCACGAGATGGAGGACGAATCCGCCATTGCCAGAAGGGTATTGGGG
                      ____________________________________________________________
consensus TTACGTGCCAATAGGCACGAGATGGAGGACGAATCCGCCATTGCCAGAAGGGTATTGGGG
 
. : . : . : . : . : . :
JMSF038A20+ AAACGCGATTCACAGCAAGCTGGCAAAGGCAAATGCAGGAGAGCTGCTGAAGAGAGGATT
rJMSF020F10+ AAACGCGATTCACAGCAAGCTGGCAAAGGCAAATGCAGGAGAGCTGCTGAAGAGAGGATT
                      ____________________________________________________________
consensus AAACGCGATTCACAGCAAGCTGGCAAAGGCAAATGCAGGAGAGCTGCTGAAGAGAGGATT
 
. : . : . : . : . : . :
JMSF038A20+ AGGCTGGGCAGCCTGGCAAATACATG
rJMSF020F10+ AGGCTGGGCAGCCTGGCAAATACATGAAGTGGTGTCTATTCAGGATCATGAAGAAGTGGT
                      ____________________________________________________________
consensus AGGCTGGGCAGCCTGGCAAATACATGAAGTGGTGTCTATTCAGGATCATGAAGAAGTGGT
 
. : . : . : . : . : . :
rJMSF020F10+ GGAGTTTTACCAGAATTGGGTGAAATCTCCTGTGATTGCCCAGAAGAGCAAAGTGTTCTT
                      ____________________________________________________________
consensus GGAGTTTTACCAGAATTGGGTGAAATCTCCTGTGATTGCCCAGAAGAGCAAAGTGTTCTT
 
. : . : . : . : . : . :
rJMSF020F10+ TGCCAACTTTCTGGGCATTGCTAGCTCCCCAAGGAACAATGTTTATGCCACTGATTTTGG
                      ____________________________________________________________
consensus TGCCAACTTTCTGGGCATTGCTAGCTCCCCAAGGAACAATGTTTATGCCACTGATTTTGG
 
. : . : . : . : . : . :
rJMSF020F10+ GTGGGGGAAGCCTGTAGCAGTGAGATGTGGAATGGACAATAAAGCTGATGGGAAGTTCAG
                      ____________________________________________________________
consensus GTGGGGGAAGCCTGTAGCAGTGAGATGTGGAATGGACAATAAAGCTGATGGGAAGTTCAG
 
. : . : . : . : . : . :
rJMSF020F10+ CCTGTTTCCTGGACTGGAAAAAGGGAGTGTGGACATTGAGGTTTGCCTTCTTCCTCACAC
                      ____________________________________________________________
consensus CCTGTTTCCTGGACTGGAAAAAGGGAGTGTGGACATTGAGGTTTGCCTTCTTCCTCACAC
 
. : . : . : . : . : . :
rJMSF020F10+ ACTACATACTTTAGGGAATGATCAAGAATTCATGGAGTTTGTTACCCATTGAGCAAAATA
                      ____________________________________________________________
consensus ACTACATACTTTAGGGAATGATCAAGAATTCATGGAGTTTGTTACCCATTGAGCAAAATA
 
. : . : . : . : . : . :
rJMSF020F10+ AACCATATTACCCTGCTCGTGAATGCCAGCAAAGCAAAACTATTAATTTAGTTTCCGATG
                      ____________________________________________________________
consensus AACCATATTACCCTGCTCGTGAATGCCAGCAAAGCAAAACTATTAATTTAGTTTCCGATG
 
. : . : . : . : . : . :
rJMSF020F10+ AAGCAAAACCATTAATTCTCCTCGGATTGATCAACCAGTTGAATTATACTTCGAAATTTG
                      ____________________________________________________________
consensus AAGCAAAACCATTAATTCTCCTCGGATTGATCAACCAGTTGAATTATACTTCGAAATTTG
 
. : . : . : . : . : . :
rJMSF020F10+ TTTAATACATATGTACCAAAGATGTGTTTGGTTCATAGATGTAGAACTATGTACTTTGGG
                      ____________________________________________________________
consensus TTTAATACATATGTACCAAAGATGTGTTTGGTTCATAGATGTAGAACTATGTACTTTGGG
 
. : . : . : . : . : . :
rJMSF020F10+ TGTGTTTGGTTCATGAGTGTAGAACTCAAAATGACAATATTTATTGTGATTGTTGCTCAT
                      ____________________________________________________________
consensus TGTGTTTGGTTCATGAGTGTAGAACTCAAAATGACAATATTTATTGTGATTGTTGCTCAT