Previous Contig 012125:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN014E24Sequence615012125 (4)sp|P42791|RL18_ARATH1e-8860S ribosomal protein L18.>gb:ATAC011620_1543306 Arabidopsis thaliana chromosome
JMSF011O09Sequence222012125 (4)gb:AY056141_15634755e-26Arabidopsis thaliana putative 60S ribosomal protein (At5g27850) mRNA, complete c130022458
JMSF020E24Sequence692012125 (4)sp|P42791|RL18_ARATH2e-8860S ribosomal protein L18.>gb:ATAC011620_1543306 Arabidopsis thaliana chromosome730012125 (4)sp|P42791|RL18_ARATH2e-8860S ribosomal protein L18.>gb:ATAC011620_1543306 Arabidopsis thaliana chromosome

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF020E24- ATCTGATTTT
                      ____________________________________________________________
consensus ATCTGATTTT
 
. : . : . : . : . : . :
JMSF020E24+ CTGTCCAAACCTATCACTCACATAACACAGAAA
rJMSF020E24- GAAAGGAACTATGGGTTTATGACTAAACTGTCCAAACCTATCACTCACATAACACAGAAA
                      ____________________________________________________________
consensus GAAAGGAACTATGGGTTTATGACTAAACTGTCCAAACCTATCACTCACATAACACAGAAA
 
. : . : . : . : . : . :
JMSF020E24+ AATTATCCCTGAGATGATGACAAAATTTAAATTTCAGCACTTACAGCTGAAGAACTAAGC
JMFN014E24+ AAAATTTAAATTTCAGCACTTACAGCTGAAGAACTAAGC
rJMSF020E24- AATTATCCCTGAGATGATGACAAAATTTAAATTTCAGCACTTACAGCTGAAGAACTAAGC
                      ____________________________________________________________
consensus AATTATCCCTGAGATGATGACAAAATTTAAATTTCAGCACTTACAGCTGAAGAACTAAGC
 
. : . : . : . : . : . :
JMSF020E24+ AATTTAAAATACCTAAATTTTATAGCCTCTGCTATTTCTCTTTCCCCTGGCTCTCTCAAA
JMFN014E24+ AATTTAAAATACCTAAATTTTATAGCCTCTGCTATTTCTCTTTCCCCTGGCTCTCTCAAA
rJMSF020E24- AATTTAAAATACCTAAATTTTATAGCCTCTGCTATTTCTCTTTCCCCTGGCTCTCTCAAA
                      ____________________________________________________________
consensus AATTTAAAATACCTAAATTTTATAGCCTCTGCTATTTCTCTTTCCCCTGGCTCTCTCAAA
 
. : . : . : . : . : . :
JMSF020E24+ TTTTCTGCCCTTGGACCTAACATAGGGCTTGATATGGCTGTGTGGCACTCCAGGAGCTCT
JMFN014E24+ TTTTCTGCCCTTGGACCTAACATAGGGCTTGATATGGCTGTGTGGCACTCCAGGAGCTCT
rJMSF020E24- TTTTCTGCCCTTGGACCTAACATAGGGCTTGATATGGCTGTGTGGCACTCCAGGAGCTCT
                      ____________________________________________________________
consensus TTTTCTGCCCTTGGACCTAACATAGGGCTTGATATGGCTGTGTGGCACTCCAGGAGCTCT
 
. : . : . : . : . : . :
JMSF020E24+ GCCAAAGTGCTTCACGGCCTCACGGGAGTTTTTAGGGCCCCGTAGAAGCACCGTGTTCTG
JMFN014E24+ GCCAAAGTGCTTCACGGCCTCACGGGAGTTTTTAGGGCCCCGTAGAAGCACCGTGTTCTG
rJMSF020E24- GCCAAAGTGCTTCACGGCCTCACGGGAGTTTTTAGGGCCCCGTAGAAGCACCGTGTTCTG
                      ____________________________________________________________
consensus GCCAAAGTGCTTCACGGCCTCACGGGAGTTTTTAGGGCCCCGTAGAAGCACCGTGTTCTG
 
. : . : . : . : . : . :
JMSF020E24+ GCCAAGAGGAGCTCGGAGAGCAAGCTGATCAAAAGTCAAGCACTCACCCCCTGCTTTCTC
JMFN014E24+ GCCAAGAGGAGCTCGGAGAGCAAGCTGATCAAAAGTCAAGCACTCACCCCCTGCTTTCTC
rJMSF020E24- GCCAAGAGGAGCTCGGAGAGCAAGCTGATCAAAAGTCAAGCACTCACCCCCTGCTTTCTC
                      ____________________________________________________________
consensus GCCAAGAGGAGCTCGGAGAGCAAGCTGATCAAAAGTCAAGCACTCACCCCCTGCTTTCTC
 
. : . : . : . : . : . :
JMSF020E24+ AATTCTAGCTCTTGCTGTCTCAGTGAATCTCAGTGCAGCTACTTTCATTTTGGGCACTTC
JMFN014E24+ AATTCTAGCTCTTGCTGTCTCAGTGAATCTCAGTGCAGCTACTTTCATTTTGGGCACTTC
rJMSF020E24- AATTCTAGCTCTTGCTGTCTCAGTGAATCTCAGTGCAGCTACTTTCATTTTGGGCACTTC
                      ____________________________________________________________
consensus AATTCTAGCTCTTGCTGTCTCAGTGAATCTCAGTGCAGCTACTTTCATTTTGGGCACTTC
 
. : . : . : . : . : . :
JMSF020E24+ ATAAGCTCTAGTATCATCAGTCACTGTCCCAACAAGAACAGCAATCTTATCCTCCTTTCC
JMFN014E24+ ATAAGCTCTAGTATCATCAGTCACTGTCCCAACAAGAACAGCAATCTTATCCTCCTTTCC
rJMSF020E24- ATAAGCTCTAGTATCATCAGTCACTGTCCCAACAAGAACAGCAATCTTATCCTCCTTTCC
                      ____________________________________________________________
consensus ATAAGCTCTAGTATCATCAGTCACTGTCCCAACAAGAACAGCAATCTTATCCTCCTTTCC
 
. : . : . : . : . : . :
JMSF020E24+ TTGGATGAATTGAATCAACCTGGAGAGAGACAGTGGAGCCTTGTTGGTTTTGCTCATAAA
JMFN014E24+ TTGGATGAATTGAATCAACCTGGAGAGAGACAGTGGAGCCTTGTTGGTTTTGCTCATAAA
JMSF011O09+ ACCTGGAGAGAGACAGTGGAGCCTTGTTGGTTTTGCTCATAAA
rJMSF020E24- TTGGATGAATTGAATCAACCTGGAGAGAGACAGTGGAGCCTTGTTGGTTTTGCTCATAAA
                      ____________________________________________________________
consensus TTGGATGAATTGAATCAACCTGGAGAGAGACAGTGGAGCCTTGTTGGTTTTGCTCATAAA
 
. : . : . : . : . : . :
JMSF020E24+ TAGCCTCTTCAGTATCGCAGCATTAAACTTGCTCTCCGTTCTCCGCACCAGAAATCGATA
JMFN014E24+ TAGCCTCTTCAGTATCGCAGCATTAAACTTGCTCTCCGTTCTCCGCACCAGAAATCGATA
JMSF011O09+ TAGCCTCTTCAGTATCGCAGCATTAAACTTGCTCTCCGTTCTCCGCACCAGAAATCGATA
rJMSF020E24- TAGCCTCTTCAGTATCGCAGCATTAAACTTGCTCTCCGTTCTCCGCACCAGAAATCGATA
                      ____________________________________________________________
consensus TAGCCTCTTCAGTATCGCAGCATTAAACTTGCTCTCCGTTCTCCGCACCAGAAATCGATA
 
. : . : . : . : . : . :
JMSF020E24+ CAACTTGACGAGCAGCTTGAGATAGACATCGTCGGACTTCGGGGCAGTGCGTTTGGTCTG
JMFN014E24+ CAACTTGACGAGCAGCTTGAGATAGACATCGTCGGACTTCGGGGCAGTGCGTTTGGTCTG
JMSF011O09+ CAACTTGACGAGCAGCTTGAGATAGACATCGTCGGACTTCGGGGCAGTGCGTTTGGTCTG
rJMSF020E24- CAACTTGACGAGCAGCTTGAGATAGACATCGTCGGACTTCGGGGCAGTGCGTTTGGTCTG
                      ____________________________________________________________
consensus CAACTTGACGAGCAGCTTGAGATAGACATCGTCGGACTTCGGGGCAGTGCGTTTGGTCTG
 
. : . : . : . : . : . :
JMSF020E24+ CTTGCTTTTGCCGCCGGCGACCAAATCTATACCCATTGCTACTGCAGCTGCTCCTGA
JMFN014E24+ CTTGCTTTTGCCGCCGGCGACCAAATCTATACCCAT
JMSF011O09+ CTTGCTTTTGCCGCCGGCGACCAAATCTATACCCATTGCTACTGCAGCTGCTCCTGA
rJMSF020E24- CTTGCTTTTGCCGCCGGCGACCAAATCTATACCCATTGCTACTGCAGCTGCTCCTGAACC
                      ____________________________________________________________
consensus CTTGCTTTTGCCGCCGGCGACCAAATCTATACCCATTGCTACTGCAGCTGCTCCTGAACC