Previous Contig 012124:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017O23Sequence152012124 (3)
JMSF015E02Sequence624012124 (3)pir|T04570|T045709e-15hypothetical protein T12H17.140 - Arabidopsis thaliana>gb:ATCHRIV57_1546112 Arab
JMSF020E22Sequence680005885 (2)gb:AY321103_15990754e-44Nicotiana benthamiana C-4 sterol methyl oxidase 1 mRNA, partial cds.660012124 (3)pir|T06618|T066182e-15hypothetical protein F16J13.180 - Arabidopsis thaliana>gb:ATCHRIV33_1544976 Arab

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF020E22+ TA
                      ____________________________________________________________
consensus TA
 
. : . : . : . : . : . :
rJMSF020E22+ TTAAAATAGGAATAAGAATCAATTGCCCTTTTTTTTTTGGGTCATATTTTCGTTCTTCAG
                      ____________________________________________________________
consensus TTAAAATAGGAATAAGAATCAATTGCCCTTTTTTTTTTGGGTCATATTTTCGTTCTTCAG
 
. : . : . : . : . : . :
rJMSF015E02+ GGTATGACCTTCCTTGGACTCCCAC
rJMSF020E22+ ATTTACTTCATACATCAATTGCCAATATTGACTCAGGTATGACCTTCCTTGGACTCCCAC
                      ____________________________________________________________
consensus ATTTACTTCATACATCAATTGCCAATATTGACTCAGGTATGACCTTCCTTGGACTCCCAC
 
. : . : . : . : . : . :
rJMSF015E02+ AAAATATATTCCTTTTTATGGTGGTCCAGATCACCATGACTACCATCANTATGTCTGGTG
rJMSF020E22+ AAAATATATTCCTTTTTATGGTGGTCCAGATCACCATGACTACCATCATTATGT-TGGTG
                      ____________________________________________________________
consensus AAAATATATTCCTTTTTATGGTGGTCCAGATCACCATGACTACCATCATTATGTCTGGTG
 
. : . : . : . : . : . :
rJMSF015E02+ GCCTAAGTCACAGCAATTTTGCTTCAGTATTCACCTATTGTGATTACATCTATGGAACTG
rJMSF020E22+ GCCTAAGTCACAGCAATTTTGCTTCAGTATTCACCTATTGTGATTACATCTATGGAACTG
                      ____________________________________________________________
consensus GCCTAAGTCACAGCAATTTTGCTTCAGTATTCACCTATTGTGATTACATCTATGGAACTG
 
. : . : . : . : . : . :
rJMSF015E02+ ACAAGGTGTGTATATAAAATTANAAATNATCTATATTGGATCAATTCTNGACAGCGATTT
rJMSF020E22+ ACAAGGTGTGTATATAAAATTATAAATAATCTATATTGGATCAATTCTCGACAGCGATTT
                      ____________________________________________________________
consensus ACAAGGTGTGTATATAAAATTATAAATAATCTATATTGGATCAATTCTCGACAGCGATTT
 
. : . : . : . : . : . :
rJMSF015E02+ ATATAGGCCGTAAGACCAAACCTTTTCTTACATTTTTTTGGCCTTAATCTCACAGGGCTA
rJMSF020E22+ ATATAGGCCGTAAGACCAAACCTTTTCTTACATTTTTTTGGCCTTAATCTCACAGGGCTA
                      ____________________________________________________________
consensus ATATAGGCCGTAAGACCAAACCTTTTCTTACATTTTTTTGGCCTTAATCTCACAGGGCTA
 
. : . : . : . : . : . :
rJMSF015E02+ CCGCTATCAAAAGAAAGTACTTCAGCAGNTACGAGAAGCCTCTAAAATCAACAGTGAACA
rJMFF017O23+ GAACA
rJMSF020E22+ CCGCTATCAAAAGAAAGTACTTCAGCAGTTACGAGAAGCCTCTAAAATCAACAGTGAACA
                      ____________________________________________________________
consensus CCGCTATCAAAAGAAAGTACTTCAGCAGTTACGAGAAGCCTCTAAAATCAACAGTGAACA
 
. : . : . : . : . : . :
rJMSF015E02+ AAATGGATTTTCACATGCAGGCGAGGAAGATGTTAAAGTTGACTAGATCTGGAGCTTCAA
rJMFF017O23+ AAATGGATTTTCACATGCAGGCGAGGAAGATGTTAAAGTNGANTAGATGTGGAGCTTCAA
rJMSF020E22+ AAATGGATTTTCACATGCAGGCGAGGAAGATGTTAAAGTTGACTAGATCTGGAGCTTCAA
                      ____________________________________________________________
consensus AAATGGATTTTCACATGCAGGCGAGGAAGATGTTAAAGTTGACTAGATCTGGAGCTTCAA
 
. : . : . : . : . : . :
rJMSF015E02+ TTACAACCTTCTTATTTCTTTACTAGNGAAGTTGTGGGAGCATGAAGTCGGGCGAGTGCT
rJMFF017O23+ TTACAACNTTTTTATTTCTTTACTAGTGAAGTNGTGGGAGCATGAAGTCGGNNGAGTGCT
rJMSF020E22+ TTACAACCTTCTTATTTCTTTACTAGTGAAGTTGTGGGAGCATGAAGTCGGGCGAGTGCT
                      ____________________________________________________________
consensus TTACAACCTTCTTATTTCTTTACTAGTGAAGTTGTGGGAGCATGAAGTCGGGCGAGTGCT
 
. : . : . : . : . : . :
rJMSF015E02+ TTGTTTTTAGTGTGCTAGTCTCATAGATTTGGAAGTTGTTAAAAAGTGGTCTTGTGTGGA
rJMFF017O23+ TTGTTTTTAGTGTGTTAGTCTCATAGA
rJMSF020E22+ TTGTTTTTAGTGTGCTAGTCTCATAGATTTGGAAGTTGTTAAAAAGTGGTCTTGTGTGGA
                      ____________________________________________________________
consensus TTGTTTTTAGTGTGCTAGTCTCATAGATTTGGAAGTTGTTAAAAAGTGGTCTTGTGTGGA
 
. : . : . : . : . : . :
rJMSF015E02+ CCTAGGGGAGAATTTTATGTACTTAGTGATAAAGTAAAAGTGGTCA
rJMSF020E22+ CCTAGGGGAGAATTTTATGTA-TTAGTGATAAAGTAAAAGTGGTCATTTGACCAGTACGT
                      ____________________________________________________________
consensus CCTAGGGGAGAATTTTATGTACTTAGTGATAAAGTAAAAGTGGTCATTTGACCAGTACGT