Previous Contig 012109:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF019O17Sequence290019142751012109 (3)pir|S28019|S280193e-18gene iojap protein - maize>gb:ZMIOJAPMR_1731912 Z.mays mRNA for iojap protein.
JMSF028A18Sequence683012109 (3)gb:AY087920_15729453e-46Arabidopsis thaliana clone 39638 mRNA, complete sequence.764012109 (3)gb:AY087920_15729453e-46Arabidopsis thaliana clone 39638 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF028A18- GCTAGTGAGGA
rJMSF028A18+ AGGA
                      ____________________________________________________________
consensus GCTAGTGAGGA
 
. : . : . : . : . : . :
JMSF028A18- GGTTGATGATGATGCTGAAAGCCTATCGTTTGCTGTAGCAGCGGCTAAAGTTGCAAATGA
rJMSF028A18+ GGTTGATGATGATGCTGAAAGCCTATCGTTTGCTGTAGCAGCGGCTAAAGTTGCAAATGA
                      ____________________________________________________________
consensus GGTTGATGATGATGCTGAAAGCCTATCGTTTGCTGTAGCAGCGGCTAAAGTTGCAAATGA
 
. : . : . : . : . : . :
JMSF028A18- GGTGAAGGCTGCTGACATAAAAGTTCTTTTTGTGAAGCCCTTAGTTTATTGGACTCGATT
rJMSF028A18+ GGTGAAGGCTGCTGACATAAAAGTTCTTTTTGTGAAGCCCTTAGTTTATTGGACTCGATT
                      ____________________________________________________________
consensus GGTGAAGGCTGCTGACATAAAAGTTCTTTTTGTGAAGCCCTTAGTTTATTGGACTCGATT
 
. : . : . : . : . : . :
JMSF028A18- TTTCATCATTGCCACTGCATTTTCCCGCCCACAAATTGATGCCGTTGGGACCAGGATAAG
rJMSF028A18+ TTTCATCATTGCCACTGCATTTTCCCGCCCACAAATTGATGCCGTTGGGACCAGGATAAG
                      ____________________________________________________________
consensus TTTCATCATTGCCACTGCATTTTCCCGCCCACAAATTGATGCCGTTGGGACCAGGATAAG
 
. : . : . : . : . : . :
JMSF028A18- AGATATGGCCGAGGAACAGTATGGAAGAGTTGCATCTGGAGATACAAAGCCGAATTCATG
rJMSF028A18+ AGATATGGCCGAGGAACAGTATGGAAGAGTTGCATCTGGAGATACAAAGCCGAATTCATG
                      ____________________________________________________________
consensus AGATATGGCCGAGGAACAGTATGGAAGAGTTGCATCTGGAGATACAAAGCCGAATTCATG
 
. : . : . : . : . : . :
JMSF028A18- GACGTTGCTGGACTTTGGTGATGTAGTGGTACATATATTTCTGCCTGAACAACGTGAGTT
rJMSF028A18+ GACGTTGCTGGACTTTGGTGATGTAGTGGTACATATATTTCTGCCTGAACAACGTGAGTT
rJMSF019O17+ GGTGATGTAGTGGTACATATATTTCTGCCTGAACAACGTGAGTT
                      ____________________________________________________________
consensus GACGTTGCTGGACTTTGGTGATGTAGTGGTACATATATTTCTGCCTGAACAACGTGAGTT
 
. : . : . : . : . : . :
JMSF028A18- CTATAACCTGGAAGAGTTCTATGCGAATGCAACACCTGTTGATCTGCCTTTTGAAAATCA
rJMSF028A18+ CTATAACCTGGAAGAGTTCTATGCGAATGCAACACCTGTTGATCTGCCTTTTGAAAATCA
rJMSF019O17+ CTATAACCTGGAAGAGTTCTATGCGAATGCAACACCTGTTGATCTGCCTTTTGAAAATCA
                      ____________________________________________________________
consensus CTATAACCTGGAAGAGTTCTATGCGAATGCAACACCTGTTGATCTGCCTTTTGAAAATCA
 
. : . : . : . : . : . :
JMSF028A18- ACAGTTTCGACAGCTAAAAGGTTTCTGAAACTTGACAATTTGAGCCTCTGATCTAGCGAA
rJMSF028A18+ ACAGTTTCGACAGCTAAAAGGTTTCTGAAACTTGACAATTTGAGCCTCTGATCTAGCGAA
rJMSF019O17+ ACAGTTTCGACAGCTAAAAGGTTTCTGAAACTTGACAATTTGAGCCTCTGATCTAGCGAA
                      ____________________________________________________________
consensus ACAGTTTCGACAGCTAAAAGGTTTCTGAAACTTGACAATTTGAGCCTCTGATCTAGCGAA
 
. : . : . : . : . : . :
JMSF028A18- GGGACTAAAAGGCCGGGTTGGCAAATCAACAGGCAGGATATGGTTGAGAATTGGCAAGAT
rJMSF028A18+ GGGACTAAAAGGCCGGGTTGGCAAATCAACAGGCAGGATATGGTTGAGAATTGGCAAGAT
rJMSF019O17+ GGGACTAAAAGGCCGGGTTGGCAAATCAACAGGCAGGATATGGTTGAGAATTGGCAAGAT
                      ____________________________________________________________
consensus GGGACTAAAAGGCCGGGTTGGCAAATCAACAGGCAGGATATGGTTGAGAATTGGCAAGAT
 
. : . : . : . : . : . :
JMSF028A18- ATCGTTGGTTAACTCCATTATATATGCCATTACCTGCTAGTGTCAACAGGAGGGAGGGGT
rJMSF028A18+ ATCGTTGGTTAACTCCATTATATATGCCATTACCTGCTAGTGTCAACAGGAGGGAGGGGT
rJMSF019O17+ ATCGTTGGTTAACTCCATTATATATGCCATTACCTGCTAGTGTCAACAGGAGGGAGGGGT
                      ____________________________________________________________
consensus ATCGTTGGTTAACTCCATTATATATGCCATTACCTGCTAGTGTCAACAGGAGGGAGGGGT
 
. : . : . : . : . : . :
JMSF028A18- TCACAAATTTTGATGATATGTGTGCTCCCTTTACTGCTCTTGATTGAAAAGGAAAAAGAT
rJMSF028A18+ TCACAAATTTTGATGATATGTGTGCTCCCTTTACTGCTCTTGATTGAAAAGGAAAAAGAT
rJMSF019O17+ TCACAAATTTTGATGATATGTGTGCTCCCTTTACTGCTCTTGATTGAAAAGGAAAAAGAT
                      ____________________________________________________________
consensus TCACAAATTTTGATGATATGTGTGCTCCCTTTACTGCTCTTGATTGAAAAGGAAAAAGAT
 
. : . : . : . : . : . :
JMSF028A18- GTAATCAACATGGCATAAAAAATGACAGGTACTCTTGTAGCCTTCCTTGTATTTGCTCCT
rJMSF028A18+ GTAATCAACATGGCATAAAAAATGACAGGTACTCTTGTAGCCTTCCTTGTATTTGCTCCT
rJMSF019O17+ GTAATCAACATGGCATAAAAAATGACAGGTACTCTTGTAGCCTTCCTTGTATTTGCTCCT
                      ____________________________________________________________
consensus GTAATCAACATGGCATAAAAAATGACAGGTACTCTTGTAGCCTTCCTTGTATTTGCTCCT
 
. : . : . : . : . : . :
JMSF028A18- AATACTTCCTAG
rJMSF028A18+ AATACTTCCTAGCAATATAAAATGAAAACATTGCATTACTCGATGAGATAGTATTTTCAG
rJMSF019O17+ AATACTTCCTAGCAATATAAAATGAAAACATTGCATTACTCGATGAGATAGTATTTTCAG
                      ____________________________________________________________
consensus AATACTTCCTAGCAATATAAAATGAAAACATTGCATTACTCGATGAGATAGTATTTTCAG
 
. : . : . : . : . : . :
rJMSF028A18+ TTCTCGTTTAACTTAGAAACTAGTGGTATGTACTTCTCAT
rJMSF019O17+ TTCTCGTTTAACTTAGAAACTAGTGGTATGTACTTCTCATTTCTGAGTGGAAGGGACATT
                      ____________________________________________________________
consensus TTCTCGTTTAACTTAGAAACTAGTGGTATGTACTTCTCATTTCTGAGTGGAAGGGACATT