Previous Contig 012106:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003D04Sequence571005850 (2)704012106 (3)
JMFF037M01Sequence685012106 (3)
JMSF019N07Sequence495005850 (2)791012106 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF019N07+ TCCAAANGGGT
                      ____________________________________________________________
consensus TCCAAANGGGT
 
. : . : . : . : . : . :
rJMSF019N07+ AANCAATTTTCAGNATCCAATGCATCCCAGACCTGAACTGGCCTACCAGGCAAAAGGGCC
                      ____________________________________________________________
consensus AANCAATTTTCAGNATCCAATGCATCCCAGACCTGAACTGGCCTACCAGGCAAAAGGGCC
 
. : . : . : . : . : . :
rJMFF037M01+ CCGTATGAAGCTACAGTTGATTGTCAGCTATCTTCAGAGCC
rJMFF003D04+ CCGTATGAAGCTACAGTTGATTGTCAGCTATCTTCAGAGCC
rJMSF019N07+ CTACTCTAACAATCTAGCCCCGTATGAAGCTACAGTTGATTGTCAGCTATCTTCAGAGCC
                      ____________________________________________________________
consensus CTACTCTAACAATCTAGCCCCGTATGAAGCTACAGTTGATTGTCAGCTATCTTCAGAGCC
 
. : . : . : . : . : . :
rJMFF037M01+ CCGTATGACCAGTAACTGTGAGAATACTGATGATCAACTTGAATCATCTGCTGCACGTAT
rJMFF003D04+ CCGTATGACCAGTAACTGTGAGAATACTGATGATCAACTTGAATCATCTGCTGCACGTAT
rJMSF019N07+ CCGTATGACCAGTAACTGTGAGAATACTGATGATCAACTTGAATCATCTGCTGCACGTAT
                      ____________________________________________________________
consensus CCGTATGACCAGTAACTGTGAGAATACTGATGATCAACTTGAATCATCTGCTGCACGTAT
 
. : . : . : . : . : . :
rJMFF037M01+ TTCTTTAGATAGCCAAAATATTTCCCATCCAGCAAACCAACCTCAAAATGCTTATGTGCC
rJMFF003D04+ TTCTTTAGATAGCCAAAATATTTCCCATCCAGCAAACCAACCTCAAAATGCTTATGTGCC
rJMSF019N07+ TTCTTTAGATAGCCAAAATATTTCCCATCCAGCAAACCAACCTCAAAATGCTTATGTGCC
                      ____________________________________________________________
consensus TTCTTTAGATAGCCAAAATATTTCCCATCCAGCAAACCAACCTCAAAATGCTTATGTGCC
 
. : . : . : . : . : . :
rJMFF037M01+ AGATATTGCATCTCTTAACTTTAATAGGGAGGTTCCATTCTGTGAAATCAATGAACCTCA
rJMFF003D04+ AGATATTGCATCTCTTAACTTTAATAGGGAGGTTCCATTCTGTGAAATCAATGAACCTCA
rJMSF019N07+ AGATATTGCATCTCTTAACTTTAATAGGGAGGTTCCATTCTGTGAAATCAATGAACCTCA
                      ____________________________________________________________
consensus AGATATTGCATCTCTTAACTTTAATAGGGAGGTTCCATTCTGTGAAATCAATGAACCTCA
 
. : . : . : . : . : . :
rJMFF037M01+ CCATGTAGCATCAGCGGACAAGTTCTTGCTCGCACCAGACCCCAACAGTCAGTTAGCTGA
rJMFF003D04+ CCATGTAGCATCAGCGGACAAGTTCTTGCTCGCACCAGACCCCAACAGTCAGTTAGCTGA
rJMSF019N07+ CCATGTAGCATCAGCGGACAAGTTCTTGCTCGCACCAGACCCCAACAGTCAGTTAGCTGA
                      ____________________________________________________________
consensus CCATGTAGCATCAGCGGACAAGTTCTTGCTCGCACCAGACCCCAACAGTCAGTTAGCTGA
 
. : . : . : . : . : . :
rJMFF037M01+ GAACTCATTGCCCAGTGCTTTGGACTTACGTTTTGATAATTGGATGTTTGAAGATCCAGT
rJMFF003D04+ GAACTCATTGCCCAGTGCTTTGGACTTACGTTTTGATAATTGGATGTTTGAAGATCCAGT
rJMSF019N07+ GAACTCATTGCCCAGTGCTTTGGACTTACGTTTTGATAATTGGATGTTTGAAGATCCAGT
                      ____________________________________________________________
consensus GAACTCATTGCCCAGTGCTTTGGACTTACGTTTTGATAATTGGATGTTTGAAGATCCAGT
 
. : . : . : . : . : . :
rJMFF037M01+ TGTTCCGAGGGTTATAGAAGTTTCTGTGCCTCTGGGATTGAATGCATACTCTCCTGAACC
rJMFF003D04+ TGTTCCGAGGGTTATAGAAGTTTCTGTGCCTCTGGGATTGAATGCATACTCTCCTGAACC
rJMSF019N07+ TGTTCCGAGGGTTATAGAAGTTTCTGTGCCTCTGGGATTGAATGCATACTCTCCTGAACC
                      ____________________________________________________________
consensus TGTTCCGAGGGTTATAGAAGTTTCTGTGCCTCTGGGATTGAATGCATACTCTCCTGAACC
 
. : . : . : . : . : . :
rJMFF037M01+ TGCCCCTCTCTGGGATTGAATTCATACTCCCCTGAACCTGCTCCTGTAGATTCTTGGAAT
rJMFF003D04+ TGCCCCTCTCTGGGATTGAATTCATACTCCCCTGAACCTGCTCCTGTAGATTCTTGGAAT
rJMSF019N07+ TGCCCCTCTCTGGGATTGAATTCATACTCCCCTGAACCTGCTCCTGTAGATTCTTGGAAT
                      ____________________________________________________________
consensus TGCCCCTCTCTGGGATTGAATTCATACTCCCCTGAACCTGCTCCTGTAGATTCTTGGAAT
 
. : . : . : . : . : . :
rJMFF037M01+ CTTTTCTAATATTTGGCCTAAAACTGGCATAATGCATCTCTGCCCTAAAATGTCTGGAGC
rJMFF003D04+ CTTTTCTAATATTTGGCCTAAAACTGGCATAATGCATCTCTGCCCTAAAATGTCTGGAGC
rJMSF019N07+ CTTTTCTAATATTTGGCCTAAAACTGGCATAATGCATCTCTGCCCTAAAATGTCTGGAGC
                      ____________________________________________________________
consensus CTTTTCTAATATTTGGCCTAAAACTGGCATAATGCATCTCTGCCCTAAAATGTCTGGAGC
 
. : . : . : . : . : . :
rJMFF037M01+ ATTTGTTTCTTGTCTGACTCACCATGCCATTTTAAAGGTTAGAGAAGGAATATACACTCT
rJMFF003D04+ ATTTGTTTCTTGTCTGACTCACCATGCCATTTTAAAGGTTAGAGAAGGAATATACACTCT
rJMSF019N07+ ATTTGTTTCTTGTCTGACTCACCATGCCATTTTAAAGGTTAGAGAAGGAATATACACTCT
                      ____________________________________________________________
consensus ATTTGTTTCTTGTCTGACTCACCATGCCATTTTAAAGGTTAGAGAAGGAATATACACTCT
 
. : . : . : . : . : . :
rJMFF037M01+ AGGTTTAACCTAGGTTTCTGTTGTACTCTAGTTATGCACTTCAAGTGTACACAGATTGCA
rJMFF003D04+ AGGTTTAACCTAGGTTTCTGTTGTACTCTAGTTATGCACTTCAAGTGTACACAGATTGCA
rJMSF019N07+ AGGTTTAACCTAGGTTTCTGTTGTACTCTAGTTATGCACTTCAAGTGTACACAGATTGCA
                      ____________________________________________________________
consensus AGGTTTAACCTAGGTTTCTGTTGTACTCTAGTTATGCACTTCAAGTGTACACAGATTGCA
 
. : . : . : . : . : . :
rJMFF037M01+ ATATCTGTACAGAGATTAGGCTCATCCAGTTGAATGGAGAGCAA
rJMFF003D04+ ATATCTGTACAGAGATTAGGCTCATCCAGTTGAATGAAGAGCAAATTATGAT
rJMSF019N07+ ATATCTGTACAGAGATTAGGCTCATCCAGTTGAATGAAGAGCAAATTATGATTAAGAAAT
                      ____________________________________________________________
consensus ATATCTGTACAGAGATTAGGCTCATCCAGTTGAATGAAGAGCAAATTATGATTAAGAAAT