Previous Contig 012100:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF019K22Sequence281012100 (2)gb:AY088898_15739069e-21Arabidopsis thaliana clone 99033 mRNA, complete sequence.>gb:BT005412_1638352 Ar805012100 (2)gb:AY088898_15739061e-62Arabidopsis thaliana clone 99033 mRNA, complete sequence.>gb:BT005412_1638352 Ar

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF019K22- GGGTTTCTGCTGAGAACATTGAGGAAAGCCATGGGTAGATCATTCAAGGATTCACTC
                      ____________________________________________________________
consensus GGGTTTCTGCTGAGAACATTGAGGAAAGCCATGGGTAGATCATTCAAGGATTCACTC
 
. : . : . : . : . : . :
JMSF019K22- AAAGCTCTGGAAGCTGATATTCAGCTCGCCAACACTATAGCATTAGGCCATCGCAGGGAG
rJMSF019K22+ CTATAGCATTAGGCCATCGCA-GGAG
                      ____________________________________________________________
consensus AAAGCTCTGGAAGCTGATATTCAGCTCGCCAACACTATAGCATTAGGCCATCGCAGGGAG
 
. : . : . : . : . : . :
JMSF019K22- CTCGATGGAGCGTGTATTCAAATGAGACTGGCCTACAGTCCAGCTTCGCAATTCTGTCTT
rJMSF019K22+ CTCGATGGAGCGTGTATTCAAATGAGACTGGCCTACAGTCCAGCTTCGCAATTCTGTCTT
                      ____________________________________________________________
consensus CTCGATGGAGCGTGTATTCAAATGAGACTGGCCTACAGTCCAGCTTCGCAATTCTGTCTT
 
. : . : . : . : . : . :
JMSF019K22- TTTCTCCTTCAATGGTTTGATTGTAAGGTTGCTGGTGCGCTTGGGCTGCTTGAAGTTCTT
rJMSF019K22+ TTTCTCCTTCAATGGTTTGATTGTAAGGTTGCTGGTGCGCTTGGGCTGCTTGAAGTTCTT
                      ____________________________________________________________
consensus TTTCTCCTTCAATGGTTTGATTGTAAGGTTGCTGGTGCGCTTGGGCTGCTTGAAGTTCTT
 
. : . : . : . : . : . :
JMSF019K22- GTATATATGGCGTATGCTGATGGTAAAACGTCTATGTACATTAA
rJMSF019K22+ GTATATATGGCGTATGCTGATGGTAAAACGTCTATGTACATTAAGGAAAGGAGAGCCAGC
                      ____________________________________________________________
consensus GTATATATGGCGTATGCTGATGGTAAAACGTCTATGTACATTAAGGAAAGGAGAGCCAGC
 
. : . : . : . : . : . :
rJMSF019K22+ ATTCGAGAATTTTATGAGATAATTTTCCCGTCACTGCAAATCCAAAGAGGGATTACTGAT
                      ____________________________________________________________
consensus ATTCGAGAATTTTATGAGATAATTTTCCCGTCACTGCAAATCCAAAGAGGGATTACTGAT
 
. : . : . : . : . : . :
rJMSF019K22+ TTCGATGAAATGAAACAGAAAGAAATATGTTCGCTCCGGTATTCGACCAAAGGGAAGCTT
                      ____________________________________________________________
consensus TTCGATGAAATGAAACAGAAAGAAATATGTTCGCTCCGGTATTCGACCAAAGGGAAGCTT
 
. : . : . : . : . : . :
rJMSF019K22+ TCTGAAATTGAATTGGAAAGGGAAGCGGAATGTGGAATCTGCTTGGAACCTAATAGCAAA
                      ____________________________________________________________
consensus TCTGAAATTGAATTGGAAAGGGAAGCGGAATGTGGAATCTGCTTGGAACCTAATAGCAAA
 
. : . : . : . : . : . :
rJMSF019K22+ GTTGTTTTGCCAGACTGCAGGCATTCGCTGCTTAAGATGCTTCCAGGAATGGCGCAGCCG
                      ____________________________________________________________
consensus GTTGTTTTGCCAGACTGCAGGCATTCGCTGCTTAAGATGCTTCCAGGAATGGCGCAGCCG
 
. : . : . : . : . : . :
rJMSF019K22+ GTCTCAGTCATGCCCCTTTTGTCGAAGCAATCTCAGACGAGTAAACTCGGATGACCTTTG
                      ____________________________________________________________
consensus GTCTCAGTCATGCCCCTTTTGTCGAAGCAATCTCAGACGAGTAAACTCGGATGACCTTTG
 
. : . : . : . : . : . :
rJMSF019K22+ GGTATGCGTGGAGAAGAGTGAAACTGTGGAGCTACCTCTAATTTTAAGGGAGGACTGGAA
                      ____________________________________________________________
consensus GGTATGCGTGGAGAAGAGTGAAACTGTGGAGCTACCTCTAATTTTAAGGGAGGACTGGAA
 
. : . : . : . : . : . :
rJMSF019K22+ GAGGCTGTATAGGTACATCGAAAATCTACCAATTATCCTCCCAGACCCGCGGTTCACTCC
                      ____________________________________________________________
consensus GAGGCTGTATAGGTACATCGAAAATCTACCAATTATCCTCCCAGACCCGCGGTTCACTCC
 
. : . : . : . : . : . :
rJMSF019K22+ CTATGGTTCTCACCTTCGGTGAGGCAGCGAGAGTGGATTGAATTCTGTACATAATTTTCT
                      ____________________________________________________________
consensus CTATGGTTCTCACCTTCGGTGAGGCAGCGAGAGTGGATTGAATTCTGTACATAATTTTCT
 
. : . : . : . : . : . :
rJMSF019K22+ CGTAAACAATATCAACAACAACAGCTTCACTATCCTGCTCTGTGAATCCCTGTTTCTATC
                      ____________________________________________________________
consensus CGTAAACAATATCAACAACAACAGCTTCACTATCCTGCTCTGTGAATCCCTGTTTCTATC
 
. : . : . : . : . : . :
rJMSF019K22+ TTTGCAGTTTCTCAAGTCATTTAGTTAGTAGTAATAGCTAGTCAAAACATTGATTGCTGT
                      ____________________________________________________________
consensus TTTGCAGTTTCTCAAGTCATTTAGTTAGTAGTAATAGCTAGTCAAAACATTGATTGCTGT