Previous Contig 012099:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF019K21Sequence258007537 (2)pir|B84807|B848074e-32probable RNA-binding protein [imported] - Arabidopsis thaliana>gb:AC005499_15327369012099 (2)
JMSF043E10Sequence694007537 (2)pir|B84807|B848071e-84probable RNA-binding protein [imported] - Arabidopsis thaliana>gb:AC005499_15327328012099 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF043E10+ TTATT
                      ____________________________________________________________
consensus TTATT
 
. : . : . : . : . : . :
rJMSF043E10+ TGCCCTGTTNCCNGAAACCNAGAANNTNTTTCGNGAAACNTACCNAGNGGGGGGGGGCCC
                      ____________________________________________________________
consensus TGCCCTGTTNCCNGAAACCNAGAANNTNTTTCGNGAAACNTACCNAGNGGGGGGGGGCCC
 
. : . : . : . : . : . :
rJMSF043E10+ NTGCGNGNGGGATTTTCCNGGGGGNTTTTACTTNTCTTTACATNTCAAANAGCNNAAANC
                      ____________________________________________________________
consensus NTGCGNGNGGGATTTTCCNGGGGGNTTTTACTTNTCTTTACATNTCAAANAGCNNAAANC
 
. : . : . : . : . : . :
rJMSF043E10+ NANGGGGGTNCCGNGGAAGGGNCNTAAGTTGTTTTTTTTTTTTNTATACAGTTGCCTTAA
rJMSF019K21+ GGAAGGGNCNTAAGTTGTTTTTTTTTTTT-TATACAGTTGCCTTAA
                      ____________________________________________________________
consensus NANGGGGGTNCCGNGGAAGGGNCNTAAGTTGTTTTTTTTTTTTNTATACAGTTGCCTTAA
 
. : . : . : . : . : . :
rJMSF043E10+ TTTATAAGGTTGGTCGTGCGAGTTGGAGTTTCGTGTGGGTTCTTGTGGAACTTCATTCTT
rJMSF019K21+ TTTATAAGGTTGGTCGTGCGAGTTGGAGTTTCGTGTGGGTTCTTGTGGAACTTCATTCTT
                      ____________________________________________________________
consensus TTTATAAGGTTGGTCGTGCGAGTTGGAGTTTCGTGTGGGTTCTTGTGGAACTTCATTCTT
 
. : . : . : . : . : . :
rJMSF043E10+ TGGATNTATNTGTCATGTTNGTAAANNGTACGTGNGAAATACTGCTAGCAAAATTACTAT
rJMSF019K21+ TGGATTTATTTGTCATGTTAGTAAATTGTA-GTGTGAAATA-TGCTAGCAAAATTACTAT
                      ____________________________________________________________
consensus TGGATTTATTTGTCATGTTAGTAAATTGTACGTGTGAAATACTGCTAGCAAAATTACTAT
 
. : . : . : . : . : . :
rJMSF043E10+ TANTATTGTTA
rJMSF019K21+ TATTATTGTTATTAGTTCATTGTAGAGGGTTAGTGGGTTNGAAAGCTTGTAGCTAATACC
                      ____________________________________________________________
consensus TATTATTGTTATTAGTTCATTGTAGAGGGTTAGTGGGTTNGAAAGCTTGTAGCTAATACC
 
. : . : . : . : . : . :
rJMSF019K21+ TTTTGCCTTGTCCATTATTTTGTTAGTGAACTGAACCAATGATGACTAATANTGTGCTAT
                      ____________________________________________________________
consensus TTTTGCCTTGTCCATTATTTTGTTAGTGAACTGAACCAATGATGACTAATANTGTGCTAT