Previous Contig 012093:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN017A17Sequence581012093 (6)gb:AC020580_15385321e-44Arabidopsis thaliana chromosome 3 BAC F5E6 genomic sequence, complete sequence.>
JMFS075H04Sequence626012093 (6)pir|T06782|T067828e-09extensin - soybean>gb:GMU44838_1680673 Glycine max extensin (SbHRGP3) gene, comp
JMSF019J18Sequence528019130pir|T10863|T108636e-09extensin precursor - kidney bean>gb:PVU18791_1702996 Phaseolus vulgaris hydroxyp767012093 (6)gb:AC020580_15385322e-44Arabidopsis thaliana chromosome 3 BAC F5E6 genomic sequence, complete sequence.>
JMSF020J18Sequence514012093 (6)gb:AC020580_15385322e-35Arabidopsis thaliana chromosome 3 BAC F5E6 genomic sequence, complete sequence.>
JMSF048D09Sequence711012093 (6)gb:AC020580_15385327e-26Arabidopsis thaliana chromosome 3 BAC F5E6 genomic sequence, complete sequence.>777012093 (6)gb:AC020580_15385322e-44Arabidopsis thaliana chromosome 3 BAC F5E6 genomic sequence, complete sequence.>

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS075H04- CACCACCTCCCAA
                      ____________________________________________________________
consensus CACCACCTCCCAA
 
. : . : . : . : . : . :
JMFS075H04- ACACGCCCCGCCGGGAGTCTCTCCACATTCCAACGCCTCTCTCTCTCTCGTTCTCGCTCT
                      ____________________________________________________________
consensus ACACGCCCCGCCGGGAGTCTCTCCACATTCCAACGCCTCTCTCTCTCTCGTTCTCGCTCT
 
. : . : . : . : . : . :
JMFS075H04- GGTATACACACGCACAAGCACAGTGCTGAAACAAGGCAGAACTTCTGAAATAATGGCTTC
                      ____________________________________________________________
consensus GGTATACACACGCACAAGCACAGTGCTGAAACAAGGCAGAACTTCTGAAATAATGGCTTC
 
. : . : . : . : . : . :
JMFS075H04- ACCTTCTGCTTCTATCAGGTACTTTTCATATCCAGTGCGACTTTATTTTGCAAGTTAATT
                      ____________________________________________________________
consensus ACCTTCTGCTTCTATCAGGTACTTTTCATATCCAGTGCGACTTTATTTTGCAAGTTAATT
 
. : . : . : . : . : . :
JMFS075H04- TTGATTTATATATATACGTGCTTGATTAAGAGATAACCGCGTCTGTCAATCTTGAATTGC
                      ____________________________________________________________
consensus TTGATTTATATATATACGTGCTTGATTAAGAGATAACCGCGTCTGTCAATCTTGAATTGC
 
. : . : . : . : . : . :
JMFS075H04- TTTGAGCCTCGTTTCTTCGAATCAGTATGTGAATCTATCATTCTAATTATCTACGGGCCA
                      ____________________________________________________________
consensus TTTGAGCCTCGTTTCTTCGAATCAGTATGTGAATCTATCATTCTAATTATCTACGGGCCA
 
. : . : . : . : . : . :
JMFS075H04- TCTCTTCATTTTTAAGTGTGCATTATATATATATATATATATATATATATATAAACACAA
                      ____________________________________________________________
consensus TCTCTTCATTTTTAAGTGTGCATTATATATATATATATATATATATATATATAAACACAA
 
. : . : . : . : . : . :
JMFS075H04- ATTCATACTATACACACTCCTTTTGAATCGATCAGGAGTTGGTGATTCAACCGATTGGTT
JMSF048D09- ATCAGGAGTTGGTGATTCAACCGATTGGTT
                      ____________________________________________________________
consensus ATTCATACTATACACACTCCTTTTGAATCGATCAGGAGTTGGTGATTCAACCGATTGGTT
 
. : . : . : . : . : . :
JMFS075H04- GGAAATTGGAATACTACATCTGATCGGATCAAACGGTAGTGCGTTAATGGCATCGGCTCT
JMSF048D09- GGAAATTGGAATACTACATCTGATCGGATCAAACGGTAGTGCGTTAATGGCATCGGCTCT
                      ____________________________________________________________
consensus GGAAATTGGAATACTACATCTGATCGGATCAAACGGTAGTGCGTTAATGGCATCGGCTCT
 
. : . : . : . : . : . :
JMFS075H04- GATGTCGAATCCGGTGATGAGCTCCGAAAGTAGAGCAGCGGCTAGGAGAAGGAAGAAGAA
JMSF048D09- GATGTCGAATCCGGTGATGAGCTCCGAAAGTAGAGCAGCGGCTAGGAGAAGGAAGAAGAA
rJMSF048D09+ GTCGAATCCGGTGATGAGCTCCGAAAGTAGAGCAGCGGCTAGGAGAAGGAAGAAGAA
rJMSF019J18+ GTGATGAGCTCCGAAAGTAGAGCAGCGGCTAGGAGAAGGAAGAAGAA
                      ____________________________________________________________
consensus GATGTCGAATCCGGTGATGAGCTCCGAAAGTAGAGCAGCGGCTAGGAGAAGGAAGAAGAA
 
. : . : . : . : . : . :
JMFS075H04- GAGAAGCCAAATTCCTAGTGCTCAAGCTGTGGACGTAAACAATAACGGCTCAACCGCTGA
JMSF048D09- GAGAAGCCAAATTCCTAGTGCTCAAGCTGTGGACGTAAACAATAACGGCTCAACCGCTGA
rJMSF048D09+ GAGAAGCCAAATTCCTAGTGCTCAAGCTGTGGACGTAAACAATAACGGCTCAACCGCTGA
JMFN017A17- AATAACGGCTCAACCGCTGA
rJMSF019J18+ GAGAAGCCAAATTCCTAGTGCTCAAGCTGTGGACGTAAACAATAACGGCTCAACCGCTGA
                      ____________________________________________________________
consensus GAGAAGCCAAATTCCTAGTGCTCAAGCTGTGGACGTAAACAATAACGGCTCAACCGCTGA
 
. : . : . : . : . : . :
JMFS075H04- ATGGAAATCCGAA
JMSF048D09- ATGGAAATCCGAAGCTCAACAACAAGTGTACTCTTCCAAGCTGTTCAAAGCGCTCCGAGA
rJMSF048D09+ ATGGAAATCCGAAGCTCAACAACAAGTGTACTCTTCCAAGCTGTTCAAAGCGCTCCGAGA
JMFN017A17- ATGGAAATCCGAAGCTCAACAACAAGTGTACTCTTCCAAGCTGTTCAAAGCGCTCCGAGA
rJMSF020J18+ CAAGCTGTTCAAAGCGCTCCGAGA
rJMSF019J18+ ATGGAAATCCGAAGCTCAACAACAAGTGTACTCTTCCAAGCTGTTCAAAGCGCTCCGAGA
                      ____________________________________________________________
consensus ATGGAAATCCGAAGCTCAACAACAAGTGTACTCTTCCAAGCTGTTCAAAGCGCTCCGAGA
 
. : . : . : . : . : . :
JMSF048D09- AGTCCGGTTGAATTCGTCGTCAGGAACGAAGGGGGGCAGAGCCGTGCACGAAGTCGCAGA
rJMSF048D09+ AGTCCGGTTGAATTCGTCGTCAGGAACGAAGGGGGGCAGAGCCGTGCACGAAGTCGCAGA
JMFN017A17- AGTCCGGTTGAATTCGTCGTCAGGAACGAAGGGGGGCAGAGCCGTGCACGAAGTCGCAGA
rJMSF020J18+ AGTCCGGTTGAATTCGTCGTCAGGAACGAAGGGGGGCAGAGCCGTGCANGAAGTCGCAGA
rJMSF019J18+ AGTCCGGTTGAATTCGTCGTCAGGAACGAAGGGGGGCAGAGCCGTGCACGAAGTCGCAGA
                      ____________________________________________________________
consensus AGTCCGGTTGAATTCGTCGTCAGGAACGAAGGGGGGCAGAGCCGTGCACGAAGTCGCAGA
 
. : . : . : . : . : . :
JMSF048D09- TAGAGTTCTGGCGGTAGCCGCCAAAGGACGCACGAGGTGGAGCCGCGCCATCCTCACTAA
rJMSF048D09+ TAGAGTTCTGGCGGTAGCCGCCAAAGGACGCACGAGGTGGAGCCGCGCCATCCTCACTAA
JMFN017A17- TAGAGTTCTGGCGGTAGCCGCCAAAGGACGCACGAGGTGGAGCCGCGCCATCCTCACTAA
rJMSF020J18+ TAGAGTTCTGGCGGTAGCCGCCAAAGGACGCANGAGGTGGAGCCGCNCCATCCTCACTAA
rJMSF019J18+ TAGAGTTCTGGCGGTAGCCGCCAAAGGACGCACGAGGTGGAGCCGCGCCATCCTCACTAA
                      ____________________________________________________________
consensus TAGAGTTCTGGCGGTAGCCGCCAAAGGACGCACGAGGTGGAGCCGCGCCATCCTCACTAA
 
. : . : . : . : . : . :
JMSF048D09- CAGGCTGAGGCTCAAGTTCATGAAGAAGCACAACAGAAGGCAGAGAATGGTGGTTGCGGC
rJMSF048D09+ CAGGCTGAGGCTCAAGTTCATGAAGAAGCACAACAGAAGGCAGAGAATGGTGGTTGCGGC
JMFN017A17- CAGGCTGAGGCTCAAGTTCATGAAGAAGCACAACAGAAGGCAGAGAATGGTGGTTGCGGC
rJMSF020J18+ CAGGCTGAGGCTCAAGTTCATGAAGAAGCACAACAGAAGGCAGAGAATGGTGGTTGCGGC
rJMSF019J18+ CAGGCTGAGGCTCAAGTTCATGAAGAAGCACAACAGAAGGCAGAGAATGGTGGTTGCGGC
                      ____________________________________________________________
consensus CAGGCTGAGGCTCAAGTTCATGAAGAAGCACAACAGAAGGCAGAGAATGGTGGTTGCGGC
 
. : . : . : . : . : . :
JMSF048D09- GGCTAACGGGAAGAGCCGGGTGCCGAAGAAATCGAGAGTAAGTATCCTCCGGCTGAAAAC
rJMSF048D09+ GGCTAACGGGAAGAGCCGGGTGCCGAAGAAATCGAGAGTAAGTATCCTCCGGCTGAAAAC
JMFN017A17- GGCTAACGGGAAGAGCCGGGTGCCGAAGAAATCGAGAGTAAGTATCCTCCGGCTGAAAAC
rJMSF020J18+ GGCTAACGGGAAGAGCCGGGTGCCGAAGAAATCGAGAGTAAGTATCCTCCGGNTGAAAAC
rJMSF019J18+ GGCTAACGGGAAGAGCCGGGTGCCGAAGAAATCGAGAGTAAGTATCCTCCGGCTGAAAAC
                      ____________________________________________________________
consensus GGCTAACGGGAAGAGCCGGGTGCCGAAGAAATCGAGAGTAAGTATCCTCCGGCTGAAAAC
 
. : . : . : . : . : . :
JMSF048D09- AAAAAACTTACCGACTGTACAGAGAAAGGCTCGTGT
rJMSF048D09+ AAAAAACTTACCGACTGTACAGAGAAAGGCTCGTGTTCTCGGGCGGCTCGTTCCTGGCTG
JMFN017A17- AAAAAACTTACCGACTGTACAGAGAAAGGCTCGTGTTCTCGGGCGGCTCGTTCCTGGCTG
rJMSF020J18+ AAAAAACTTACCGNCTGTACAGAGAAANGNTCGTGTTNTNGGGCGGNTCGTTCCNGGNTG
rJMSF019J18+ AAAAAACTTACCGACTGTACAGAGAAAGGCTCGTGTTCTCGGGCGGCTCGTTCCTGGCTG
                      ____________________________________________________________
consensus AAAAAACTTACCGACTGTACAGAGAAAGGCTCGTGTTCTCGGGCGGCTCGTTCCTGGCTG
 
. : . : . : . : . : . :
rJMSF048D09+ CCGGAAGGAGCCGCTGCCTGTGATTCTAGAAGAAGCCACTGATTATATAGCGGCTTTAGA
JMFN017A17- CCGGAAGGAGCCGCTGCCTGTGATTCTAGAAGAAGCCACTGATTATATAGCGGCTTTAGA
rJMSF020J18+ CCGGAAGGAGCCGCTGCCTGTGATTCTAGAAGAAGCCACTGATTATATAGCGGCTTTAGA
rJMSF019J18+ CCGGAAGGAGCCGCTGCCTGTGATTCTAGAAGAAGCCACTGATTATATAGCGGCTTTAGA
                      ____________________________________________________________
consensus CCGGAAGGAGCCGCTGCCTGTGATTCTAGAAGAAGCCACTGATTATATAGCGGCTTTAGA
 
. : . : . : . : . : . :
rJMSF048D09+ GATGCAAGTCCGCGCCATGAGCACTTTAGCTCAACTGCTTTCCGGTGGCGGTGGTTCTTC
JMFN017A17- GATGCAAGTCCGCGCCATGAGCACTTTAGCTCAACTGCTTTCCGG
rJMSF020J18+ GATGCAAGTCCGCGCCATGAGCACNTTAGNTCATCTGCTTTCCGGNGGCGGTGGTTCTTC
rJMSF019J18+ GATGCAAGTCCGCGCCATGAGCACTTTAGCTCAACTGCTTTCCGGTGGCGGTGGTTCTTC
                      ____________________________________________________________
consensus GATGCAAGTCCGCGCCATGAGCACTTTAGCTCAACTGCTTTCCGGTGGCGGTGGTTCTTC
 
. : . : . : . : . : . :
rJMSF048D09+ TTCTTCTTCTAGCTCCGCTCCTCTTAATCCGCCTGGCTCCAGCCGGCCTCCTCAGAGTTG
rJMSF020J18+ TTCTTNTTCTAGNTCCGCTCCTCNTAATCCGCCNGGCTCCAGCCGGCCTCCTCAGAGTTG
rJMSF019J18+ TTCTTCTTCTAGCTCCGCTCCTCTTAATCCGCCTGGCTCCAGCCGGCCTCCTCAGAGTTG
                      ____________________________________________________________
consensus TTCTTCTTCTAGCTCCGCTCCTCTTAATCCGCCTGGCTCCAGCCGGCCTCCTCAGAGTTG
 
. : . : . : . : . : . :
rJMSF048D09+ ATGATGACTTTGACTCTTCATTTTTCTTTATTATTTTTTTAAATATTACAAATTTTCTTC
rJMSF020J18+ ATGATGACTT
rJMSF019J18+ ATGATGACTTTGACTCTTCATTTTTCTTTATTATTTTTTTAAATATTACAAATTTTCTTC
                      ____________________________________________________________
consensus ATGATGACTTTGACTCTTCATTTTTCTTTATTATTTTTTTAAATATTACAAATTTTCTTC
 
. : . : . : . : . : . :
rJMSF048D09+ TATTATCGTGCTCTATATCTCTTATGAACATCCCCTGTTAAATATGTCATCTTCTTCTCT
rJMSF019J18+ TATTATCGTGCTCTATATCTCTTATGAACATCCCCTGTTAAATATGTCATCTTCTTCTCT
                      ____________________________________________________________
consensus TATTATCGTGCTCTATATCTCTTATGAACATCCCCTGTTAAATATGTCATCTTCTTCTCT