Previous Contig 012089:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF019I17Sequence497019124gb:AP002061_18217872e-13Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone: T21E2.776012089 (2)gb:AP002061_18217871e-77Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone: T21E2.
JMSF045G23Sequence746012089 (2)gb:AP005700_18562934e-53Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJN751006226 (23)pir|C96574|C965745e-63hypothetical protein T3F20.25 [imported] - Arabidopsis thaliana>gb:AE005173_8932

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF045G23- AAATTGTGGGGGAGGCGATGTTGTAATTGATGGCACTACATATGAC
                      ____________________________________________________________
consensus AAATTGTGGGGGAGGCGATGTTGTAATTGATGGCACTACATATGAC
 
. : . : . : . : . : . :
JMSF045G23- GCAGATAAAGATTCTACAGGCTATGCGCAATTTGTTTCTAACAAAGAGAACTGGGTAACT
                      ____________________________________________________________
consensus GCAGATAAAGATTCTACAGGCTATGCGCAATTTGTTTCTAACAAAGAGAACTGGGTAACT
 
. : . : . : . : . : . :
JMSF045G23- AGTAATACGGGGTACTTTTGGGACAGAACCTTAAATTTATCTGACTATACAGCAACAAAT
                      ____________________________________________________________
consensus AGTAATACGGGGTACTTTTGGGACAGAACCTTAAATTTATCTGACTATACAGCAACAAAT
 
. : . : . : . : . : . :
JMSF045G23- GTATCAGTCATCAAAGAAAAAGACTCCGAAATCTACCAGACGGCTCGTTTGTCTCCTTTA
                      ____________________________________________________________
consensus GTATCAGTCATCAAAGAAAAAGACTCCGAAATCTACCAGACGGCTCGTTTGTCTCCTTTA
 
. : . : . : . : . : . :
JMSF045G23- TCTCTGACATATCACGGACGCTGTTTAGCGAATGGAAACTACAATGTGAAACTTCATTTT
rJMSF019I17+ TGTTTAGCAAATGGAAACTATACTGTGAAACTCTATTTT
                      ____________________________________________________________
consensus TCTCTGACATATCACGGACGCTGTTTAGCGAATGGAAACTATACTGTGAAACTTTATTTT
 
. : . : . : . : . : . :
JMSF045G23- GCAGAGATAGTTTTGAGAGATAATAGCTCTTTTCAAAGTCTTGGTAGACGCATATTTGAT
rJMSF019I17+ GCAGAGATAGTTCTGAGAGATAATAGATCTTTTCAAAGTCTTGGAAGACGCATGTTCGAT
                      ____________________________________________________________
consensus GCAGAGATAGTTTTGAGAGATAATAGCTCTTTTCAAAGTCTTGGTAGACGCATGTTTGAT
 
. : . : . : . : . : . :
JMSF045G23- GTTTATATACAGGGTGAAAGGAAATTAAAGGATTTTGATATTGAAACTGAAGCACAAGGA
rJMSF019I17+ GTTTATATTCAGGGCGAAAGGAAATTAAAGGATTTTGATATTGAAACTGCAGCACAAGGA
                      ____________________________________________________________
consensus GTTTATATTCAGGGTGAAAGGAAATTAAAGGATTTTGATATTGAAACTGCAGCACAAGGA
 
. : . : . : . : . : . :
JMSF045G23- GCCGATAAGGCTTTAGTTAAACAATTCGAAGCAGTTGTCAGAGATAAAACTCTCGAGGTG
rJMSF019I17+ GTTGATAAAGCCTTAGTTAAACAATTTCATGCAGTTGTCAGAGATAAAACTCTCGAGTTG
                      ____________________________________________________________
consensus GTTGATAAGGCTTTAGTTAAACAATTTGATGCAGTTGTCAGAGATAAAACTCTCGAGTTG
 
. : . : . : . : . : . :
JMSF045G23- CGCTTTGAATATGCTGGAAAAGGAACAACAGCAGCTCCAATTAAAGGATCATATGGACCT
rJMSF019I17+ CGCTTTGAGTATGCTGAAAAGGGAACAACAGTAGTCCCACTTCCAGGAGTATATGGCCCT
                      ____________________________________________________________
consensus CGCTTTGAGTATGCTGGAAAGGGAACAACAGTAGTTCCACTTCCAGGATTATATGGCCCT
 
. : . : . : . : . : . :
JMSF045G23- TTAGTATCTGCCATTTCTGTGGAATCTGATTTCAAATCTGCCAAAGAGAGAAAGAGATTG
rJMSF019I17+ TTAATATCTGCCATTTCTGTGGAATCTGATTTCAAGCCTCCCAAAAATATGAAGGCTTTA
                      ____________________________________________________________
consensus TTAGTATCTGCCATTTCTGTGGAATCTGATTTCAAGTCTGCCAAAGATATGAAGGGTTTG
 
. : . : . : . : . : . :
JMSF045G23- ATCATACTTGTCGCAGTAGCTGCTTCTTTGTTTCTTATTTTTGCAATTCTCTGCTTTGCT
rJMSF019I17+ ATCATAGCTGTTGCAACGGCTTCTTCTTTGTTTCTTGTTTTCACAATTCTCTGTTTTGCT
                      ____________________________________________________________
consensus ATCATAGTTGTTGCAGTGGCTTCTTCTTTGTTTCTTGTTTTTGCAATTCTCTGTTTTGCT
 
. : . : . : . : . : . :
JMSF045G23- GGGTGGAAGATTTACATTAGAAACAAGGTCTCACAGGAAAAGGAGCTACNAGGCCTTGAT
rJMSF019I17+ GGGTGGAAGATCTACACTAGAAACAAGACCTCAAAAGAAAGGGAACTACGAGGCCTTGAT
                      ____________________________________________________________
consensus GGGTGGAAGATTTACATTAGAAACAAGGTCTCACAGGAAAGGGAGCTACGAGGCCTTGAT
 
. : . : . : . : . : . :
JMSF045G23- CTACGAACTCGTCTATTTACCATGAGACAAATTAAAG
rJMSF019I17+ CTACGAACTGGACTATTTACCTTAAGACAAATTAAAGCCGCTACAAACAACTTTGATGCT
                      ____________________________________________________________
consensus CTACGAACTGGTCTATTTACCTTGAGACAAATTAAAGCCGCTACAAACAACTTTGATGCT
 
. : . : . : . : . : . :
rJMSF019I17+ TCAAATAAGATTGGTGAAGGTGGATTTGGACCAGTCTACAAGGGCATATTATTGGATGGT
                      ____________________________________________________________
consensus TCAAATAAGATTGGTGAAGGTGGATTTGGACCAGTCTACAAGGGCATATTATTGGATGGT
 
. : . : . : . : . : . :
rJMSF019I17+ ACCGTTATTGCTGTGAAACAACTCTCGTCAAAATCAAGACAGGGAAACCATGAATTTTTG
                      ____________________________________________________________
consensus ACCGTTATTGCTGTGAAACAACTCTCGTCAAAATCAAGACAGGGAAACCATGAATTTTTG
 
. : . : . : . : . : . :
rJMSF019I17+ AATGAAATAAGCATGATTTCTTGTTTTCACCACCCTAATCTTGTGAAACTTTATGGGTGT
                      ____________________________________________________________
consensus AATGAAATAAGCATGATTTCTTGTTTTCACCACCCTAATCTTGTGAAACTTTATGGGTGT
 
. : . : . : . : . : . :
rJMSF019I17+ TGTGTTGAGGGAACGCAATTGCTGCTAGTGTATGAGTACTGGAAAACAACAGCCTTCCCA
                      ____________________________________________________________
consensus TGTGTTGAGGGAACGCAATTGCTGCTAGTGTATGAGTACTGGAAAACAACAGCCTTCCCA