Previous Contig 012087:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF019I12Sequence544012087 (2)gb:AF159254_17732174e-62Zantedeschia aethiopica ascorbate peroxidase (cmApx) mRNA, complete cds.738012087 (2)gb:AF159254_17732176e-82Zantedeschia aethiopica ascorbate peroxidase (cmApx) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF019I12- GGTCGTATACCTGTAAGCATTGCGATTCAGTTGA
                      ____________________________________________________________
consensus GGTCGTATACCTGTAAGCATTGCGATTCAGTTGA
 
. : . : . : . : . : . :
JMSF019I12- ATAAAACCGCGCACCGATTATTTCATCATTTTACTTTCTCGAGCTCTGATCCAATGGCGG
                      ____________________________________________________________
consensus ATAAAACCGCGCACCGATTATTTCATCATTTTACTTTCTCGAGCTCTGATCCAATGGCGG
 
. : . : . : . : . : . :
JMSF019I12- TAGCACCAGCAGTGGACGCCGAGTATCTGAAGGAAATAGAGCTGACAAGGGGAGATCTCC
                      ____________________________________________________________
consensus TAGCACCAGCAGTGGACGCCGAGTATCTGAAGGAAATAGAGCTGACAAGGGGAGATCTCC
 
. : . : . : . : . : . :
JMSF019I12- GATCTGTCATCTCCAGCATGAACATTGCTCCTCTCATGCTTCGCTTGGCGTGGCATGATG
                      ____________________________________________________________
consensus GATCTGTCATCTCCAGCATGAACATTGCTCCTCTCATGCTTCGCTTGGCGTGGCATGATG
 
. : . : . : . : . : . :
JMSF019I12- CCGGCACGTATGATGCCTTTACGAAGACTGGAGGTCCTAATGGATCCATTAGAAATCCGG
rJMSF019I12+ GATCCATTAGAAATCCGG
                      ____________________________________________________________
consensus CCGGCACGTATGATGCCTTTACGAAGACTGGAGGTCCTAATGGATCCATTAGAAATCCGG
 
. : . : . : . : . : . :
JMSF019I12- AAGAATACACGCATGCTGCCAATGCTGGATTGAAACTTGCAATTGATATTTGCGAGGAAG
rJMSF019I12+ AAGAATACACGCATGCTGCCAATGCTGGATTGAAACTTGCAATTGATATTTGCGAGGAAG
                      ____________________________________________________________
consensus AAGAATACACGCATGCTGCCAATGCTGGATTGAAACTTGCAATTGATATTTGCGAGGAAG
 
. : . : . : . : . : . :
JMSF019I12- TAAAAACCTATCATCCAAAAATTACATATGCTGACCTCTACCAGCTTGCTGGGGTTGTTG
rJMSF019I12+ TAAAAACCTATCATCCAAAAATTACATATGCTGACCTCTACCAGCTTGCTGGGGTTGTTG
                      ____________________________________________________________
consensus TAAAAACCTATCATCCAAAAATTACATATGCTGACCTCTACCAGCTTGCTGGGGTTGTTG
 
. : . : . : . : . : . :
JMSF019I12- CTGTTGAGGTCACTGGAGGTCCTATCATCGATTTCGTCCCCGGTAGAAAGGACTCATTGG
rJMSF019I12+ CTGTTGAGGTCACTGGAGGTCCTATCATCGATTTCGTCCCCGGTAGAAAGGACTCATTGG
                      ____________________________________________________________
consensus CTGTTGAGGTCACTGGAGGTCCTATCATCGATTTCGTCCCCGGTAGAAAGGACTCATTGG
 
. : . : . : . : . : . :
JMSF019I12- AGTCACCAGAAGAAGGGCGCCTTCCTGATGCCNAACAAGGTCCATCTCACCTGAGAAGTG
rJMSF019I12+ AGTCACCAGAAGAAGGGCGCCTTCCTGATGCCAAACAAGGTCCATCTCACCTGAGAAGTG
                      ____________________________________________________________
consensus AGTCACCAGAAGAAGGGCGCCTTCCTGATGCCAAACAAGGTCCATCTCACCTGAGAAGTG
 
. : . : . : . : . : . :
JMSF019I12- TCTTCCATAGAATGGGCTTAACTGACAAGG
rJMSF019I12+ TCTTCCATAGAATGGGCTTAACTGACAAGGATATTGTGGCATTGTCTGGAGGCCACACAC
                      ____________________________________________________________
consensus TCTTCCATAGAATGGGCTTAACTGACAAGGATATTGTGGCATTGTCTGGAGGCCACACAC
 
. : . : . : . : . : . :
rJMSF019I12+ TGGGAAAAGCTCACAGGGACAGATCAGGCTTTGAGGGCCAGTGGACCAAGGAGCCTTTGA
                      ____________________________________________________________
consensus TGGGAAAAGCTCACAGGGACAGATCAGGCTTTGAGGGCCAGTGGACCAAGGAGCCTTTGA
 
. : . : . : . : . : . :
rJMSF019I12+ AATTTGATAATTCATATTTTGTGGAACTTCTTAAAGGAGATTCTGATGACCTATTAAAAC
                      ____________________________________________________________
consensus AATTTGATAATTCATATTTTGTGGAACTTCTTAAAGGAGATTCTGATGACCTATTAAAAC
 
. : . : . : . : . : . :
rJMSF019I12+ TGCCCACGGATAAAGCTCTGATGGAAGATCCTAAATTCCGCCAGTATGTGCTACTTTATG
                      ____________________________________________________________
consensus TGCCCACGGATAAAGCTCTGATGGAAGATCCTAAATTCCGCCAGTATGTGCTACTTTATG
 
. : . : . : . : . : . :
rJMSF019I12+ CCGAGGATGAAGAGGCATTTTTCAGAGATTATGCAGAGTCTCACAAGAAGTTGTCAGAGC
                      ____________________________________________________________
consensus CCGAGGATGAAGAGGCATTTTTCAGAGATTATGCAGAGTCTCACAAGAAGTTGTCAGAGC
 
. : . : . : . : . : . :
rJMSF019I12+ TGGGCTTTACTTCACCACCTTCCTCTACTAAGTTGTGCGGGAGAGTTGTGATTGGAGTTG
                      ____________________________________________________________
consensus TGGGCTTTACTTCACCACCTTCCTCTACTAAGTTGTGCGGGAGAGTTGTGATTGGAGTTG
 
. : . : . : . : . : . :
rJMSF019I12+ CAGTTGCAGCTGCAGTTGCAATCCTAAGTTACTATTACGCCTAGTACTGAACACACACCC
                      ____________________________________________________________
consensus CAGTTGCAGCTGCAGTTGCAATCCTAAGTTACTATTACGCCTAGTACTGAACACACACCC
 
. : . : . : . : . : . :
rJMSF019I12+ CCAAAGACTCAAGAACAATAATTGCTACTGAAAATGAACCATGAAAATTGTAATATCTTT
                      ____________________________________________________________
consensus CCAAAGACTCAAGAACAATAATTGCTACTGAAAATGAACCATGAAAATTGTAATATCTTT