Previous Contig 012084:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF006K11Sequence352005828 (2)gb:CQ871351_14546909e-21Sequence 3 from Patent WO2004078983.438012084 (2)gb:CQ871351_14546903e-59Sequence 3 from Patent WO2004078983.
JMSF019H24Sequence241005828 (2)gb:CQ871351_14546900.024Sequence 3 from Patent WO2004078983.730012084 (2)gb:CQ871351_14546904e-92Sequence 3 from Patent WO2004078983.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF019H24+ CACATGAACT
                      ____________________________________________________________
consensus CACATGAACT
 
. : . : . : . : . : . :
rJMSF019H24+ TTCTGAAACACTATTGGGAAGGTGACGAGGAGGAGAAGAAGGAAATGAAAACGCAGCTGT
                      ____________________________________________________________
consensus TTCTGAAACACTATTGGGAAGGTGACGAGGAGGAGAAGAAGGAAATGAAAACGCAGCTGT
 
. : . : . : . : . : . :
rJMSF019H24+ TTGCTGCAGATCCTCCAGTCCTGTATGTTCTTCACTATTTAGGGTTGAAACCGTGGCTAT
                      ____________________________________________________________
consensus TTGCTGCAGATCCTCCAGTCCTGTATGTTCTTCACTATTTAGGGTTGAAACCGTGGCTAT
 
. : . : . : . : . : . :
rJMSF006K11+ ACTGGAATGTTGAGAAATTGCACGAGTTTGCAAGTGATG
rJMSF019H24+ GCTTCCGCGACTATGATTGCAACTGGAATGTTGAGAAATTGCACGAGTTTGCAAGTGATG
                      ____________________________________________________________
consensus GCTTCCGCGACTATGATTGCAACTGGAATGTTGAGAAATTGCACGAGTTTGCAAGTGATG
 
. : . : . : . : . : . :
rJMSF006K11+ TTGCGCATAGGACATGGTGGAAAATCCACGATGCAATGCCGGAGAACTTGCACAAGTACT
rJMSF019H24+ TTGCGCATAGGACATGGTGGAAAATCCACGATGCAATGCCGGAGAACTTGCACAAGTACT
                      ____________________________________________________________
consensus TTGCGCATAGGACATGGTGGAAAATCCACGATGCAATGCCGGAGAACTTGCACAAGTACT
 
. : . : . : . : . : . :
rJMSF006K11+ GCTTGCTTAGATCCAAACAGAAGGCGGCCTTGGAGTGGGATCGAAGGGAAGCCGAGAAAG
rJMSF019H24+ GCTTGCTTAGATCCAAACAGAAGGCGGCCTTGGAGTGGGATCGAAGGGAAGCCGAGAAAG
                      ____________________________________________________________
consensus GCTTGCTTAGATCCAAACAGAAGGCGGCCTTGGAGTGGGATCGAAGGGAAGCCGAGAAAG
 
. : . : . : . : . : . :
rJMSF006K11+ GTAACTACACAGATGGCCATTGGAAGGTCAAGATAAAAGACCCGCGATTACAGATATGTT
rJMSF019H24+ GTAACTACACAGATGGCCATTGGAAGGTCAAGATAAAAGACCCGCGATTACAGATATGTT
                      ____________________________________________________________
consensus GTAACTACACAGATGGCCATTGGAAGGTCAAGATAAAAGACCCGCGATTACAGATATGTT
 
. : . : . : . : . : . :
rJMSF006K11+ TTGAAGATTTTTGCTTCTGGGAGAGCATGCTATGGCACTGGGGAGAAACAAATTGGACAG
rJMSF019H24+ TTGAAGATTTTTGCTTCTGGGAGAGCATGCTATGGCACTGGGGAGAAACAAATTGGACAG
                      ____________________________________________________________
consensus TTGAAGATTTTTGCTTCTGGGAGAGCATGCTATGGCACTGGGGAGAAACAAATTGGACAG
 
. : . : . : . : . : . :
rJMSF006K11+ ATAATTCAACTTCTACTCCAACACCACCTATGGTTAAAACTGTTTCGCTCTCGTCTTTAT
rJMSF019H24+ ATAATTCAACTTCTACTCCAACACCACCTATGGTTAAAACTGTTTCGCTCTCGTCTTTAT
                      ____________________________________________________________
consensus ATAATTCAACTTCTACTCCAACACCACCTATGGTTAAAACTGTTTCGCTCTCGTCTTTAT
 
. : . : . : . : . : . :
rJMSF006K11+ AATTGGAGGATGTATATGACAGAAGAATCAGCACTTAGCTATGGAAATTGAAAGAATGCT
rJMSF019H24+ AATTGGAGGATGTATATGACAGAAGAATCAGCACTTAGCTATGGAAATTGAAAGAATGCT
                      ____________________________________________________________
consensus AATTGGAGGATGTATATGACAGAAGAATCAGCACTTAGCTATGGAAATTGAAAGAATGCT
 
. : . : . : . : . : . :
rJMSF006K11+ ACAGTGTATAAGTATATTCTTTTGCTTCTTGAACTCAAT
rJMSF019H24+ ACAGTGTATAAGTATATTCTTTTGCTTCTTGAACTCAATTGCTTAGCCACTTCATCTGTT
                      ____________________________________________________________
consensus ACAGTGTATAAGTATATTCTTTTGCTTCTTGAACTCAATTGCTTAGCCACTTCATCTGTT
 
. : . : . : . : . : . :
rJMSF019H24+ GAAGCTCTATGTATAAGTATTTTCCTGCACATTGTTAACCTCCCTCTCCCTCTCCCTCTC
                      ____________________________________________________________
consensus GAAGCTCTATGTATAAGTATTTTCCTGCACATTGTTAACCTCCCTCTCCCTCTCCCTCTC
 
. : . : . : . : . : . :
rJMSF019H24+ CCTTACCCATCACAACATGCCCATTTGGAAAAGCTCTTGCTAATGGGATTATAGAGATTT
                      ____________________________________________________________
consensus CCTTACCCATCACAACATGCCCATTTGGAAAAGCTCTTGCTAATGGGATTATAGAGATTT