Previous Contig 012081:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF019H11Sequence516005826 (2)pir|E84471|E844713e-48probable beta-1,3-glucanase [imported] - Arabidopsis thaliana>gb:AC006555_153445731012081 (2)pir|E84471|E844714e-50probable beta-1,3-glucanase [imported] - Arabidopsis thaliana>gb:AC006555_153445
JMSF047O06Sequence684006692 (5)pir|E84471|E844714e-72probable beta-1,3-glucanase [imported] - Arabidopsis thaliana>gb:AC006555_153445741012081 (2)pir|E84471|E844711e-82probable beta-1,3-glucanase [imported] - Arabidopsis thaliana>gb:AC006555_153445

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF047O06+ TTAAAGTACGATGACATCAAAATGGTGGTGACTGAAACCGGCTGGCC
                      ____________________________________________________________
consensus TTAAAGTACGATGACATCAAAATGGTGGTGACTGAAACCGGCTGGCC
 
. : . : . : . : . : . :
rJMSF047O06+ GTCCAAAGGCGACTCCAAAGAAGTCGGCGCCGGCGTAGAGAACGCCGCCGCGTACAACGG
                      ____________________________________________________________
consensus GTCCAAAGGCGACTCCAAAGAAGTCGGCGCCGGCGTAGAGAACGCCGCCGCGTACAACGG
 
. : . : . : . : . : . :
rJMSF047O06+ CAACCTGGTGCGCCGAGTGCTCACCGGCGGCGGGACCCCCTTAAGACCTCACGAAGAACT
                      ____________________________________________________________
consensus CAACCTGGTGCGCCGAGTGCTCACCGGCGGCGGGACCCCCTTAAGACCTCACGAAGAACT
 
. : . : . : . : . : . :
rJMSF047O06+ CACCGTATACCTCTTCGCCCTCTTCAACGAGAACAAGAAGATCGGGCCGTCGTCGGAGAG
                      ____________________________________________________________
consensus CACCGTATACCTCTTCGCCCTCTTCAACGAGAACAAGAAGATCGGGCCGTCGTCGGAGAG
 
. : . : . : . : . : . :
rJMSF047O06+ AAACTTCGGACTGTTCTACCCGAACGGGAAAAAAGTCTACGACATACCGTTCACAACGCA
                      ____________________________________________________________
consensus AAACTTCGGACTGTTCTACCCGAACGGGAAAAAAGTCTACGACATACCGTTCACAACGCA
 
. : . : . : . : . : . :
rJMSF047O06+ AGGGCTAAAGGGGTACCACGACAGGCGGTCTCCGGCCGTCGGCGGCCACATTCTCTCCAA
                      ____________________________________________________________
consensus AGGGCTAAAGGGGTACCACGACAGGCGGTCTCCGGCCGTCGGCGGCCACATTCTCTCCAA
 
. : . : . : . : . : . :
rJMSF047O06+ ATCGGCTCGGGGAAAGACATGGTGCGTGGCAAACGGGAAAGCCGGGAAAGAAAAACTTCA
rJMSF019H11+ AGACGTGGTGCGTGGCGAACGGGGAAGCGGGAAAAGAAAGGCTGCA
                      ____________________________________________________________
consensus ATCGGCTCGGGGAAAGACGTGGTGCGTGGCGAACGGGGAAGCGGGGAAAGAAAGGCTTCA
 
. : . : . : . : . : . :
rJMSF047O06+ GGCCGGTCTAGACTTCGCTTGCGGAGAAGGTGGAGTTGATTGCCGTTCGATCCAACCGGG
rJMSF019H11+ GGCGGGTCTAGACTACGCTTGCGGTGAGGGCGGGGCGGACTGCCGTTCGATCCAGCCGGG
                      ____________________________________________________________
consensus GGCGGGTCTAGACTTCGCTTGCGGTGAGGGTGGGGTTGATTGCCGTTCGATCCAGCCGGG
 
. : . : . : . : . : . :
rJMSF047O06+ TTCCACGTGTTACAATCCTAACACTCTTGAGGCCCACGCTTCGTTCGCGTTCAACAGTTA
rJMSF019H11+ ATCCACGTGCTACAATCCTAACACTCTAGAGGCGCACGCTTCGTTCGCTTTCAACAGTTA
                      ____________________________________________________________
consensus TTCCACGTGTTACAATCCTAACACTCTTGAGGCGCACGCTTCGTTCGCTTTCAACAGTTA
 
. : . : . : . : . : . :
rJMSF047O06+ TTATCAGAAGAAGGG
rJMSF019H11+ CTATCAGAGGAAGGGGCGTGCCGGCGGCACGTGCTACTTCGGCGGGGCCGCCTACGTTGT
                      ____________________________________________________________
consensus TTATCAGAGGAAGGGGCGTGCCGGCGGCACGTGCTACTTCGGCGGGGCCGCCTACGTTGT
 
. : . : . : . : . : . :
rJMSF019H11+ CATGCAACAACCTAAATTTGGGAACTGTGAATTACCCACTGAAGATTGAACACCCCCATA
                      ____________________________________________________________
consensus CATGCAACAACCTAAATTTGGGAACTGTGAATTACCCACTGAAGATTGAACACCCCCATA
 
. : . : . : . : . : . :
rJMSF019H11+ GGCCATAGCAGACTTTGATGACCAAAAAGTCCAAAACTTTATTGGATTTTGAATGAAGTG
                      ____________________________________________________________
consensus GGCCATAGCAGACTTTGATGACCAAAAAGTCCAAAACTTTATTGGATTTTGAATGAAGTG
 
. : . : . : . : . : . :
rJMSF019H11+ TAGTGCATAGATGCTACTACTAGAGTGTCTATGGAAATTACTGCGCTTATCTATCCAGGA
                      ____________________________________________________________
consensus TAGTGCATAGATGCTACTACTAGAGTGTCTATGGAAATTACTGCGCTTATCTATCCAGGA
 
. : . : . : . : . : . :
rJMSF019H11+ ATCACCATAGTTACTGTTGGGTTTAGTGAATTCATTTTTGTGATTGTGGGGGGGAAAACT
                      ____________________________________________________________
consensus ATCACCATAGTTACTGTTGGGTTTAGTGAATTCATTTTTGTGATTGTGGGGGGGAAAACT
 
. : . : . : . : . : . :
rJMSF019H11+ AATGTAATGTGTATTAAGTTGTTACATAGTACTCTGTAATTTCTTTTCCCTTTTCATTGT
                      ____________________________________________________________
consensus AATGTAATGTGTATTAAGTTGTTACATAGTACTCTGTAATTTCTTTTCCCTTTTCATTGT
 
. : . : . : . : . : . :
rJMSF019H11+ CTACTGCTAGTACTACTTACAGCTTATAATGTTGATTAATCTCTGTAGTGCATTCAGTTG
                      ____________________________________________________________
consensus CTACTGCTAGTACTACTTACAGCTTATAATGTTGATTAATCTCTGTAGTGCATTCAGTTG