Previous Contig 012072:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF036C11Sequence470007784 (6)sp|O24381|TLC1_SOLTU3e-26Plastidic ATP/ADP-transporter.>pir|T07420|T07420 ATP/ADP-transporter, chloroplas679012072 (7)sp|O24381|TLC1_SOLTU7e-55Plastidic ATP/ADP-transporter.>pir|T07420|T07420 ATP/ADP-transporter, chloroplas
JMFS050H01Sequence512012072 (7)sp|O24381|TLC1_SOLTU3e-58Plastidic ATP/ADP-transporter.>pir|T07420|T07420 ATP/ADP-transporter, chloroplas
JMFS142E03Sequence597012072 (7)sp|O24381|TLC1_SOLTUe-104Plastidic ATP/ADP-transporter.>pir|T07420|T07420 ATP/ADP-transporter, chloroplas
JMSF015F20Sequence224007784 (6)782012072 (7)sp|O24381|TLC1_SOLTU9e-73Plastidic ATP/ADP-transporter.>pir|T07420|T07420 ATP/ADP-transporter, chloroplas
JMSF019F10Sequence227007784 (6)822012072 (7)sp|O24381|TLC1_SOLTU2e-83Plastidic ATP/ADP-transporter.>pir|T07420|T07420 ATP/ADP-transporter, chloroplas
JMSF021F03Sequence609007784 (6)sp|O24381|TLC1_SOLTU2e-49Plastidic ATP/ADP-transporter.>pir|T07420|T07420 ATP/ADP-transporter, chloroplas805012072 (7)sp|O24381|TLC1_SOLTU3e-83Plastidic ATP/ADP-transporter.>pir|T07420|T07420 ATP/ADP-transporter, chloroplas
JMSF047H21Sequence705007784 (6)sp|O24381|TLC1_SOLTU1e-66Plastidic ATP/ADP-transporter.>pir|T07420|T07420 ATP/ADP-transporter, chloroplas810012072 (7)sp|O24381|TLC1_SOLTU8e-78Plastidic ATP/ADP-transporter.>pir|T07420|T07420 ATP/ADP-transporter, chloroplas

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS142E03- AGCATCAACCTTGTTGAGGTTACATGGAA
                      ____________________________________________________________
consensus AGCATCAACCTTGTTGAGGTTACATGGAA
 
. : . : . : . : . : . :
JMFS142E03- ATCGAAGCTCAAAGCTCAGTTCCCAAGCCCGAATGAGTATTCATCTTTCATGGGCGATTT
                      ____________________________________________________________
consensus ATCGAAGCTCAAAGCTCAGTTCCCAAGCCCGAATGAGTATTCATCTTTCATGGGCGATTT
 
. : . : . : . : . : . :
JMFS142E03- CTCAACTGCCACCGGAATTGCAACTTTTACAATGATGTTGCTAAGCCAATGGGTGTTTGA
rJMSF047H21+ GGTGTTTGA
rJMSF015F20+ GGTGTTTGA
rJMSF021F03+ GGTGTTTGA
rJMSF019F10+ TTTACAATGATGTTGCTAAGCCAATGGGTGTTTGA
                      ____________________________________________________________
consensus CTCAACTGCCACCGGAATTGCAACTTTTACAATGATGTTGCTAAGCCAATGGGTGTTTGA
 
. : . : . : . : . : . :
JMFS142E03- CAAGTATGGTTGGGGAGTAGCAGCAAAGATAACGCCAACCGTCTTGCTCCTTACTGGAGT
rJMSF047H21+ CAAGTATGGTTGGGGAGTAGCAGCAAAGATAACGCCAACCGTCTTGCTCCTTACTGGAGT
rJMSF015F20+ CAAGTATGG-TNGGGAGTAGCAGCAAAGATAACGCCAACCGTCTTGCTCCTTACTGGAGT
rJMSF021F03+ CAAGTATGGTTGGGGAGTAGCAGCAAAGATAACGCCAACCGTCTTGCTCCTTACTGGAGT
rJMSF019F10+ CAAGTATGGTTGGGGAGTAGCAGCAAAGATAACGCCAACCGTCTTGCTCCTTACTGGAGT
                      ____________________________________________________________
consensus CAAGTATGGTTGGGGAGTAGCAGCAAAGATAACGCCAACCGTCTTGCTCCTTACTGGAGT
 
. : . : . : . : . : . :
JMFS142E03- TGGCTTCTTTTCCCTTATTTTGTTCGGTGCCCCCCTCGCACCTACTCTTGCAACGTTCGG
rJMSF047H21+ TGGCTTCTTTTCCCTTATTTTGTTCGGTGCCCCCCTCGCACCTACTCTTGCAACGTTCGG
JMFS050H01- ATTTGGTTCGGTGCCCCCCTCGCACCTACTCTTGCAACGTTCGG
rJMSF015F20+ TGGCTTCTTTTCCCTTATTTTGTTCGGTGCCCCCCTCGCACCTACTCTTGCAACGTTCGG
rJMSF021F03+ TGGCTTCTTTTCCCTTATTTTGTTCGGTGCCCCCCTCGCACCTACTCTTGCAACGTTCGG
rJMFF036C11+ TACTCTTGCAACGTTCGG
rJMSF019F10+ TGGCTTCTTTTCCCTTATTTTGTTCGGTGCCCCCCTCGCACCTACTCTTGCAACGTTCGG
                      ____________________________________________________________
consensus TGGCTTCTTTTCCCTTATTTTGTTCGGTGCCCCCCTCGCACCTACTCTTGCAACGTTCGG
 
. : . : . : . : . : . :
JMFS142E03- GATGACTCCTCTTCTAGCGGCAGTTTATGTGGGCGCGATGCAGAACATTTTCAGTAAGAG
rJMSF047H21+ GATGACTCCTCTTCTAGCGGCAGTTTATGTGGGCGCGATGCAGAACATTTTCAGTAAGAG
JMFS050H01- GATGACTCCTCTTCTAGCGGCAGTTTATGTGGGCGCGATGCAGAACATTTTCAGTAAGAG
rJMSF015F20+ GATGACTCCTCTTCTAGCGGCAGTTTATGTGGGCGCGATGCAGAACATTTTCAGTAAGAG
rJMSF021F03+ GATGACTCCTCTTCTAGCGGCAGTTTATGTGGGCGCGATGCAGAACATTTTCAGTAAGAG
rJMFF036C11+ GATGACTCNTCTTCTAGCGGCAGTTTATGTGGGCGCGATGCAGAACATTTTCAGTAAGAG
rJMSF019F10+ GATGACTCCTCTTCTAGCGGCAGTTTATGTGGGCGCGATGCAGAACATTTTCAGTAAGAG
                      ____________________________________________________________
consensus GATGACTCCTCTTCTAGCGGCAGTTTATGTGGGCGCGATGCAGAACATTTTCAGTAAGAG
 
. : . : . : . : . : . :
JMFS142E03- TGCAAAATACAGCTTATTTGATCCATGCAAGGAAATGGCATACATTCCCTTAGATGAGGA
rJMSF047H21+ TGCAAAATACAGCTTATTTGATCCATGCAAGGAAATGGCATACATTCCCTTAGATGAGGA
JMFS050H01- TGCAAAATACAGCTTATTTGATCCATGCAAGGAAATGGCATACATTCCCTTAGATGAGGA
rJMSF015F20+ TGCAAAATACAGCTTATTTGATCCATGCAAGGAAATGGCATACATTCCCTTAGATGAGGA
rJMSF021F03+ TGCAAAATACAGCTTATTTGATCCATGCAAGGAAATGGCATACATTCCCTTAGATGAGGA
rJMFF036C11+ TCCAAAATACAGCTTATTTGATCCATGCAAGGAAATGGCATACATTCCCTTAGATGAGGA
rJMSF019F10+ TGCAAAATACAGCTTATTTGATCCATGCAAGGAAATGGCATACATTCCCTTAGATGAGGA
                      ____________________________________________________________
consensus TGCAAAATACAGCTTATTTGATCCATGCAAGGAAATGGCATACATTCCCTTAGATGAGGA
 
. : . : . : . : . : . :
JMFS142E03- CACCAAGGTGAAAGGCAAAGCCGCGATTGATGTAGTTTGCAATCCATTGGGGAAGTCCGG
rJMSF047H21+ CACCAAGGTGAAAGGCAAAGCCGCGATTGATGTAGTTTGCAATCCATTGGGGAAGTCCGG
JMFS050H01- CACCAAGGTGAAAGGCAAAGCCGCGATTGATGTAGTTTGCAATCCATTGGGGAAGTCCGG
rJMSF015F20+ CACCAAGGTGAAAGGCAAAGCCGCGATTGATGTAGTTTGCAATCCATTGGGGAAGTCCGG
rJMSF021F03+ CACCAAGGTGAAAGGCAAAGCCGCGATTGATGTAGTTTGCAATCCATTGGGGAAGTCCGG
rJMFF036C11+ CACCAAGGTGAAAGGCAAAGCCGCGATTGATGTAGTTTGCAATCCATTGGGGAAGTCCGG
rJMSF019F10+ CACCAAGGTGAAAGGCAAAGCCGCGATTGATGTAGTTTGCAATCCATTGGGGAAGTCCGG
                      ____________________________________________________________
consensus CACCAAGGTGAAAGGCAAAGCCGCGATTGATGTAGTTTGCAATCCATTGGGGAAGTCCGG
 
. : . : . : . : . : . :
JMFS142E03- TGGAGCTTTGATACAGCAATTCATGATATTAACATTTGGTTCGCTTGCCAACTCGACTCC
rJMSF047H21+ TGGAGCTTTGATACAGCAATTCATGATATTAACATTTGGTTCGCTTGCCAACTCGACTCC
JMFS050H01- TGGAGCTTTGATACAGCAATTCATGATATTAACATTTGGTTCGCTTGCCAACTCGACTCC
rJMSF015F20+ TGGAGCTTTGATACAGCAATTCATGATATTAACATTTGGTTCGCTTGCCAACTCGACTCC
rJMSF021F03+ TGGAGCTTTGATACAGCAATTCATGATATTAACATTTGGTTCGCTTGCCAACTCGACTCC
rJMFF036C11+ TGGAGCTTTGATACAGCAATTCATGATATTAACATTTGGTTCGCTTGCCAACTCGACTCC
rJMSF019F10+ TGGAGCTTTGATACAGCAATTCATGATATTAACATTTGGTTCGCTTGCCAACTCGACTCC
                      ____________________________________________________________
consensus TGGAGCTTTGATACAGCAATTCATGATATTAACATTTGGTTCGCTTGCCAACTCGACTCC
 
. : . : . : . : . : . :
JMFS142E03- TTACCTCGGAGGCGTTCTCTTGGTTATCGTTCTCGCATGGTTGTCAGCGGCTAAGTCTTT
rJMSF047H21+ TTACCTCGGAGGCGTTCTCTTGGTTATCGTTCTCGCATGGTTGTCAGCGGCTAAGTCTTT
JMFS050H01- TTACCTCGGAGGCGTTCTCTTGGTTATCGTTCTCGCATGGATGTCAGCGGCTAAGTCTTT
rJMSF015F20+ TTACCTCGGAGGCGTTCTCTTGGTTATCGTTCTCGCATGGTTGTCAGCGGCTAAGTCTTT
rJMSF021F03+ TTACCTCGGAGGCGTTCTCTTGGTTATCGTTCTCGCATGGTTGTCAGCGGCTAAGTCTTT
rJMFF036C11+ TTACCTCGGAGGCGTTCTCTTGGTTATCGTTCTCGCATGGTTGTCAGCGGCTAAGTCTTT
rJMSF019F10+ TTACCTCGGAGGCGTTCTCTTGGTTATCGTTCTCGCATGGTTGTCAGCGGCTAAGTCTTT
                      ____________________________________________________________
consensus TTACCTCGGAGGCGTTCTCTTGGTTATCGTTCTCGCATGGTTGTCAGCGGCTAAGTCTTT
 
. : . : . : . : . : . :
JMFS142E03- GGATGTTCAGTTCACTGCTTTGCGACGA
rJMSF047H21+ GGATGTTCAGTTCACTGCTTTGCGACGAGAAGAAGAGCTCGAGAAGGAGATGGAGAGGGC
JMFS050H01- GGATGTTCAGTTCACTGCTTTGCGACGAGAAGAAGAGCTCGAGAAGGAGATGGAGAGGGC
rJMSF015F20+ GGATGTTCAGTTCACTGCTTTGCGACGAGAAGAAGAGCTCGAGAAGGAGATGGAGAGGGC
rJMSF021F03+ GGATGTTCAGTTCACTGCTTTGCGACGAGAAGAAGAGCTCGAGAAGGAGATGGAGAGGGC
rJMFF036C11+ GGATGTTCAGTTCACTGCTTTGCGACGAGAAGAAGAGCTCGAGAAGGAGATGGAGAGGGC
rJMSF019F10+ GGATGTTCAGTTCACTGCTTTGCGACGAGAAGAAGAGCTCGAGAAGGAGATGGAGAGGGC
                      ____________________________________________________________
consensus GGATGTTCAGTTCACTGCTTTGCGACGAGAAGAAGAGCTCGAGAAGGAGATGGAGAGGGC
 
. : . : . : . : . : . :
rJMSF047H21+ AGCCGCCCTGAAAATCCCCGTCGTGTCTGAAGGTGGAAATGGTTCAGCGTCATCAGTGAA
JMFS050H01- AGCCGCCCTGAAAATCCCCGTCGTGTCTGAAGGTGGAAATGGTTCAACGTCATCANTGAA
rJMSF015F20+ AGCCGCCCTGAAAATCCCCGTCGTGTCTGAAGGTGGAAATGGTTCAGCGTCATCAGTGAA
rJMSF021F03+ AGCCGCCCTGAAAATCCCCGTCGTGTCTGAAGGTGGAAATGGTTCAGCGTCATCAGTGAA
rJMFF036C11+ AGCCGCCCTGAAAATCCCCGTCGTGTCTGAAGGTGGAAATGGTTCAGCGTCATCAGTGAA
rJMSF019F10+ AGCCGCCCTGAAAATCCCCGTCGTGTCTGAAGGTGGAAATGGTTCAGCGTCATCAGTGAA
                      ____________________________________________________________
consensus AGCCGCCCTGAAAATCCCCGTCGTGTCTGAAGGTGGAAATGGTTCAGCGTCATCAGTGAA
 
. : . : . : . : . : . :
rJMSF047H21+ CCCCATCGAAGGCGGCATCGAAGGCGGCGCTTCTGCTGAACCCTACCCCCGCCCCCGGAA
JMFS050H01- CCCCATCGAAGGCGG
rJMSF015F20+ CCCCATCGAAGGCGGCATCGAAGGCGGCGCTTCTGCTGAACCCTACCCCCGCCCCCGGAA
rJMSF021F03+ CCCCATCGAAGGCGGCATCGAAGGCGGCGCTTCTGCTGAACCCTACCCCCGCCCCTGGAA
rJMFF036C11+ CCCCATCGAAGGCGGCATCGAAGGCGGCGCTTCTGCTGAACCCTACCCCCGCCCCCGGAA
rJMSF019F10+ CCCCATCGAAGGCGGCATCGAAGGCGGCGCTTCTGCTGAACCCTACCCCCGCCCCCGGAA
                      ____________________________________________________________
consensus CCCCATCGAAGGCGGCATCGAAGGCGGCGCTTCTGCTGAACCCTACCCCCGCCCCCGGAA
 
. : . : . : . : . : . :
rJMSF047H21+ CGTGTGATGATGATTGATACCGATACCCCTTAGGCTCTTACATATCTTCCCGAATAATCG
rJMSF015F20+ CGTGTGATGATGATTGATACCGATACCCCTTAGGCTCTTACATATCTTCCCGAATAATCG
rJMSF021F03+ CGTGTGATGATGATTGATACCGATACCCCTTAGGCTCTTACATATCTTCCCGAATAATCG
rJMFF036C11+ CGTGTGATGATGATTGATACCGATACCCCTTAGGCTCTTACATATCTTCCCGAATAATCG
rJMSF019F10+ CGTGTGATGATGATTGATACCGATACCCCTTAGGCTCTTACATATCTTCCCGAATAATCG
                      ____________________________________________________________
consensus CGTGTGATGATGATTGATACCGATACCCCTTAGGCTCTTACATATCTTCCCGAATAATCG
 
. : . : . : . : . : . :
rJMSF047H21+ GAAGTTGTTAGGTGCAACAATTTGGAGAAGTTATTGAATGTTGTTTTGTCATAGGAATTT
rJMSF015F20+ GAAGTTGTTAGGTGCAACAATTTGGAGAAGTTATTGAATGTTGTTTTGTCATAGGAATTT
rJMSF021F03+ GAAGTTGTTAGGTGCAACAATTTGGAGAAGTTATTGAATGTTGTTTTGTCATAGGAATTT
rJMFF036C11+ GAAGTTGTTAGGTGCAACAATTTGGAGAAGTTATTGAATGTTGTTTTGTCATAGGAATTT
rJMSF019F10+ GAAGTTGTTAGGTGCAACAATTTGGAGAAGTTATTGAATGTTGTTTTGTCATAGGAATTT
                      ____________________________________________________________
consensus GAAGTTGTTAGGTGCAACAATTTGGAGAAGTTATTGAATGTTGTTTTGTCATAGGAATTT
 
. : . : . : . : . : . :
rJMSF047H21+ GTTATTATGATCAGTAGAAATAATCTGTAGTATAAAATCAGGCTTTGCACTGAT
rJMSF015F20+ GTTATTATGATCAGTAGAAATAATCTGTAGTATAAAATCAGGCTTTGCACTGAT
rJMSF021F03+ GTTATTATGATCAGTAGAAATAATCTGTAGTATAAAATC
rJMFF036C11+ GTTATTATGATCAGTAGAAATAATCTGTAGTATAAAATCAGGCTTTGCACTGAT
rJMSF019F10+ GTTATTATGATCAGTAGAAATAATCTGTAGTATAAAATCAGGCTTTGCACTGATAAATTT
                      ____________________________________________________________
consensus GTTATTATGATCAGTAGAAATAATCTGTAGTATAAAATCAGGCTTTGCACTGATAAATTT