Previous Contig 012071:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF012C19Sequence477012071 (8)gb:AP003537_18305612e-51Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B114746012071 (8)gb:AB026636_15170721e-59Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K14A17.
JMSF019E23Sequence505012071 (8)gb:AP003537_18305617e-50Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B114747012071 (8)gb:AB026636_15170722e-60Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K14A17.
JMSF023H19Sequence690012071 (8)gb:AC119288_17396174e-89Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0017J22, complet747012071 (8)gb:AB026636_15170722e-60Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K14A17.
JMSF052I16Sequence673012071 (8)gb:AP003537_18305612e-75Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B114908012071 (8)gb:AB026636_15170721e-74Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K14A17.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF012C19- GGCTCTAATCTGTGACTCTGTTAGCAAAGAAAGCAGAGTTGAA
JMSF019E23- ATCTGTGACTCTGTTAGCAAAGAAAGCAGAGTTGAA
JMSF052I16- ATCTGTGACTCTGTTAGCAAAGAAAGCAGAGTTGAA
                      ____________________________________________________________
consensus GGCTCTAATCTGTGACTCTGTTAGCAAAGAAAGCAGAGTTGAA
 
. : . : . : . : . : . :
JMSF012C19- ATGGCGCCTCCTAATAGAACATTTTTACTTGTTGGTTTTCTTGTTATCTGGGTTTTATGC
JMSF019E23- ATGGCGCCTCCTAATAGAACATTTTTACTTGTTGGTTTTCTTGTTATCTGGGTTTTATGC
JMSF052I16- ATGGCGCCTCCTAATAGAACATTTTTACTTGTTGGTTTTCTTGTTATCTGGGTTTTATGC
                      ____________________________________________________________
consensus ATGGCGCCTCCTAATAGAACATTTTTACTTGTTGGTTTTCTTGTTATCTGGGTTTTATGC
 
. : . : . : . : . : . :
JMSF012C19- GCAGAATCATCATCCCCAAAAGCAGCACAGGAATCAGATAAGATAGGATATTTGCCAGGC
JMSF019E23- GCAGAATCATCATCCCCAAAAGCAGCACAGGAATCAGATAAGATAGGATATTTGCCAGGC
JMSF052I16- GCAGAATCATCATCCCCAAAAGCAGCACAGGAATCAGATAAGATAGGATATTTGCCAGGC
                      ____________________________________________________________
consensus GCAGAATCATCATCCCCAAAAGCAGCACAGGAATCAGATAAGATAGGATATTTGCCAGGC
 
. : . : . : . : . : . :
JMSF012C19- CAACCAAGCGCCCCATTGCTCACCCACTTCTCTGGCTACATCACTGTAAATCAATCCCAT
JMSF019E23- CAACCAAGCGCCCCATTGCTCACCCACTTCTCTGGCTACATCACTGTAAATCAATCCCAT
JMSF052I16- CAACCAAGCGCCCCATTGCTCACCCACTTCTCTGGCTACATCACTGTAAATCAATCCCAT
                      ____________________________________________________________
consensus CAACCAAGCGCCCCATTGCTCACCCACTTCTCTGGCTACATCACTGTAAATCAATCCCAT
 
. : . : . : . : . : . :
JMSF012C19- GGGAGGGCCCTTTTCTACTGGTTCTTTGAGGCTAAATCTCACCCCTCCAACAAGCCTCTA
JMSF019E23- GGGAGGGCCCTTTTCTACTGGTTCTTTGAGGCTAAATCTCACCCCTCCAACAAGCCTCTA
JMSF052I16- GGGAGGGCCCTTTTCTACTGGTTCTTTGAGGCTAAATCTCACCCCTCCAACAAGCCTCTA
JMSF023H19- GGCTAAATCTCACCCCTCCAACAAGCCTCTA
                      ____________________________________________________________
consensus GGGAGGGCCCTTTTCTACTGGTTCTTTGAGGCTAAATCTCACCCCTCCAACAAGCCTCTA
 
. : . : . : . : . : . :
JMSF012C19- GTCCTCTGGCTTAATGGAGGACCTGGTTGCTCTTCAATTGGGTATGGAGCAGCTGCAGAG
JMSF019E23- GTCCTCTGGCTTAATGGAGGACCTGGTTGCTCTTCAATTGGGTATGGAGCAGCTGCAGAG
JMSF052I16- GTCCTCTGGCTTAATGGAGGACCTGGTTGCTCTTCAATTGGGTATGGAGCAGCTGCAGAG
JMSF023H19- GTCCTCTGGCTTAATGGAGGACCTGGTTGCTCTTCAATTGGGTATGGAGCAGCTGCAGAG
                      ____________________________________________________________
consensus GTCCTCTGGCTTAATGGAGGACCTGGTTGCTCTTCAATTGGGTATGGAGCAGCTGCAGAG
 
. : . : . : . : . : . :
JMSF012C19- CTGGGCCCTCTCAGAGTTAAGAGAAATGGGGTTGGCCTTCACTTCAACAAGTATTCTTGG
JMSF019E23- CTGGGCCCTCTCAGAGTTAAGAGAAATGGGGTTGGCCTTCACTTCAACAAGTATTCTTGG
JMSF052I16- CTGGGCCCTCTCAGAGTTAAGAGAAATGGGGTTGGCCTTCACTTCAACAAGTATTCTTGG
JMSF023H19- CTGGGCCCTCTCAGAGTTAAGAGAAATGGGGTTGGCCTTCACTTCAACAAGTATTCTTGG
                      ____________________________________________________________
consensus CTGGGCCCTCTCAGAGTTAAGAGAAATGGGGTTGGCCTTCACTTCAACAAGTATTCTTGG
 
. : . : . : . : . : . :
JMSF012C19- AATAAAGAAGCCAATTTGTTGTTTGTGGAGTCTCCAGTTGGGGTTGGGTTCTCATACACA
JMSF019E23- AATAAAGAAGCCAATTTGTTGTTTGTGGAGTCTCCAGTTGGGGTTGGGTTCTCATACACA
JMSF052I16- AATAAAGAAGCCAATTTGTTGTTTGTGGAGTCTCCAGTTGGGGTTGGGTTCTCATACACA
JMSF023H19- AATAAAGAAGCCAATTTGTTGTTTGTGGAGTCTCCAGTTGGGGTTGGGTTCTCATACACA
                      ____________________________________________________________
consensus AATAAAGAAGCCAATTTGTTGTTTGTGGAGTCTCCAGTTGGGGTTGGGTTCTCATACACA
 
. : . : . : . : . : . :
JMSF012C19- AACACATCCTCTGA
JMSF019E23- AACACATCCTCTGATTTAACCACATTGGATGACAAATTTG
JMSF052I16- AACACATCCTCTGATTTAACCACATTGGATGACAAATTTGTTGCTCAAGATACCTACAAC
JMSF023H19- AACACATCCTCTGATTTAACCACATTGGATGACAAATTTGTTGCTCAAGATACCTACAAC
                      ____________________________________________________________
consensus AACACATCCTCTGATTTAACCACATTGGATGACAAATTTGTTGCTCAAGATACCTACAAC
 
. : . : . : . : . : . :
JMSF052I16- TTTCTGGTCAATTGGTTGGAAAGGTTCCCGCAGTTCAAGGGTCATGACTTCTTCATAGCA
JMSF023H19- TTTCTGGTCAATTGGTTGGAAAGGTTCCCGCAGTTCAAGGGTCATGACTTCTTCATAGCA
                      ____________________________________________________________
consensus TTTCTGGTCAATTGGTTGGAAAGGTTCCCGCAGTTCAAGGGTCATGACTTCTTCATAGCA
 
. : . : . : . : . : . :
JMSF052I16- GGAGAGAGCTACGCAGGACACTACGTACCCCAACTGGCCGAGGTTGTGTTTGATAGAAAC
JMSF023H19- GGAGAGAGCTACGCAGGACACTACGTACCCCAACTGGCCGAGGTTGTGTTTGATAGAAAC
                      ____________________________________________________________
consensus GGAGAGAGCTACGCAGGACACTACGTACCCCAACTGGCCGAGGTTGTGTTTGATAGAAAC
 
. : . : . : . : . : . :
JMSF052I16- AGGGATAGGGGAATATACCCACGCATAAATCTCAA
JMSF023H19- AGGGATAGGGGAATATACCCACGCATAAATCTCAAAGGTTTCATAGTGGGGAACCCGGAA
                      ____________________________________________________________
consensus AGGGATAGGGGAATATACCCACGCATAAATCTCAAAGGTTTCATAGTGGGGAACCCGGAA
 
. : . : . : . : . : . :
JMSF023H19- ACGAATGATTATTATGATTATAAAGGCTTGTTAGAATATGCGTGGAGTCATGCCATAATT
                      ____________________________________________________________
consensus ACGAATGATTATTATGATTATAAAGGCTTGTTAGAATATGCGTGGAGTCATGCCATAATT
 
. : . : . : . : . : . :
JMSF023H19- TCAGATCAACAGTATGATAAAGCGAAAGAAGTATGTGATTTTACACAGGAAAACTGGTCT
rJMSF052I16+ ACTGGTCT
                      ____________________________________________________________
consensus TCAGATCAACAGTATGATAAAGCGAAAGAAGTATGTGATTTTACACAGGAAAACTGGTCT
 
. : . : . : . : . : . :
JMSF023H19- GATAAATGCAATGAAGCAATGTCTATTGTATTCACCAAGTACGAAGAAATTGATATCTAC
rJMSF052I16+ GATAAATGCAATGAAGCAATGTCTATTGTATTCACCAAGTACGAAGAAATTGATATCTAC
                      ____________________________________________________________
consensus GATAAATGCAATGAAGCAATGTCTATTGTATTCACCAAGTACGAAGAAATTGATATCTAC
 
. : . : . : . : . : . :
JMSF023H19- NACATCTATGGTCCCAGATGTCTTCTAAATGGTTCTTCTTCGGCAACTGGTATCCG
rJMSF052I16+ AACATCTATGGTCCCAGATGTCTTCTAAATGGTTCTTCTTCGGCAACTGGTATCCGTGGT
                      ____________________________________________________________
consensus AACATCTATGGTCCCAGATGTCTTCTAAATGGTTCTTCTTCGGCAACTGGTATCCGTGGT
 
. : . : . : . : . : . :
rJMSF023H19+ ACTTATGCATACAGGAGGATGAAGCGA
rJMSF012C19+ ACTTATGCATACAGGAGGATGAAGCGA
rJMSF052I16+ GTGCTGGATCTTGCTCTTACTAATAAGGAAAGAACTTATGCATACAGGAGGATGAAGCGA
rJMSF019E23+ ACTTATGCATACAGGAGGATGAAGCGA
                      ____________________________________________________________
consensus GTGCTGGATCTTGCTCTTACTAATAAGGAAAGAACTTATGCATACAGGAGGATGAAGCGA
 
. : . : . : . : . : . :
rJMSF023H19+ ATACCCGGGGGTTATGATCCATGCTATTCCCCATATGCGGAGGAATACTTCAACAGGATT
rJMSF012C19+ ATACCCGGGGGTTATGATCCATGCTATTCCCCATATGCGGAGGAATACTTCAACAGGATT
rJMSF052I16+ ATACCCGGGGGTTATGATCCATGCTATTCCCCATATGCGGAGGAATACTTCAACAGGATT
rJMSF019E23+ ATACCCGGGGGTTATGATCCATGCTATTCCCCATATGCGGAGGAATACTTCAACAGGATT
                      ____________________________________________________________
consensus ATACCCGGGGGTTATGATCCATGCTATTCCCCATATGCGGAGGAATACTTCAACAGGATT
 
. : . : . : . : . : . :
rJMSF023H19+ GATGTTCAAAAGGCTTTCCATGCAAATATTAGAGCACCGGGTTCTACTGTCAACTGGAAG
rJMSF012C19+ GATGTTCAAAAGGCTTTCCATGCAAATATTAGAGCACCGGGTTCTACTGTCAACTGGAAG
rJMSF052I16+ GATGTTCAAAAGGCTTTCCATGCAAATATTAGAGCACCGGGTTCTACTGTCAACTGGAAG
rJMSF019E23+ GATGTTCAAAAGGCTTTCCATGCAAATATTAGAGCACCGGGTTCTACTGTCAACTGGAAG
                      ____________________________________________________________
consensus GATGTTCAAAAGGCTTTCCATGCAAATATTAGAGCACCGGGTTCTACTGTCAACTGGAAG
 
. : . : . : . : . : . :
rJMSF023H19+ ACATGCAGTGATCCAGTATTTAGGGCATACAAATACACTACGTTCTCTCTACTGCCTGTG
rJMSF012C19+ ACATGCAGTGATCCAGTATTTAGGGCATACAAATACACTACGTTCTCTCTACTGCCTGTG
rJMSF052I16+ ACATGCAGTGATCCAGTATTTAGGGCATACAAATACACTACGTTCTCTCTACTGCCTGTG
rJMSF019E23+ ACATGCAGTGATCCAGTATTTAGGGCATACAAATACACTACGTTCTCTCTACTGCCTGTG
                      ____________________________________________________________
consensus ACATGCAGTGATCCAGTATTTAGGGCATACAAATACACTACGTTCTCTCTACTGCCTGTG
 
. : . : . : . : . : . :
rJMSF023H19+ TATGAAAAGCTAATCAAAGGCGGTCTCAAGATTTGGATTTACAGTGGGGATGCCGATGGG
rJMSF012C19+ TATGAAAAGCTAATCAAAGGCGGTCTCAAGATTTGGATTTACAGTGGGGATGCCGATGGG
rJMSF052I16+ TATGAAAAGCTAATCAAAGGCGGTCTCAAGATTTGGATTTACAGTGGGGATGCCGATGGG
rJMSF019E23+ TATGAAAAGCTAATCAAAGGCGGTCTCAAGATTTGGATTTACAGTGGGGATGCCGATGGG
                      ____________________________________________________________
consensus TATGAAAAGCTAATCAAAGGCGGTCTCAAGATTTGGATTTACAGTGGGGATGCCGATGGG
 
. : . : . : . : . : . :
rJMSF023H19+ AGAGTACCAGTAATTGGGTCAAGATACTGCATAGAAGCTCTTAAACTGCCTCTGAAATCC
rJMSF012C19+ AGAGTACCAGTAATTGGGTCAAGATACTGCATAGAAGCTCTTAAACTGCCTCTGAAATCC
rJMSF052I16+ AGAGTACCAGTAATTGGGTCAAGATACTGCATAGAAGCTCTTAAACTGCCTCTGAAATCC
rJMSF019E23+ AGAGTACCAGTAATTGGGTCAAGATACTGCATAGAAGCTCTTAAACTGCCTCTGAAATCC
                      ____________________________________________________________
consensus AGAGTACCAGTAATTGGGTCAAGATACTGCATAGAAGCTCTTAAACTGCCTCTGAAATCC
 
. : . : . : . : . : . :
rJMSF023H19+ CCCTGGCGATCGTGGTTCCATAATCATCAGGTAGGAGGAAGGATAGTCGAGTACCATGGG
rJMSF012C19+ CCCTGGCGATCGTGGTTCCATAATCATCAGGTAGGAGGAAGGATAGTCGAGTACCATGGG
rJMSF052I16+ CCCTGGCGATCGTGGTTCCATAATCATCAGGTAGGAGGAAGGATAGTCGAGTACCATGGG
rJMSF019E23+ CCCTGGCGATCGTGGTTCCATAATCATCAGGTAGGAGGAAGGATAGTCGAGTACCATGGG
                      ____________________________________________________________
consensus CCCTGGCGATCGTGGTTCCATAATCATCAGGTAGGAGGAAGGATAGTCGAGTACCATGGG
 
. : . : . : . : . : . :
rJMSF023H19+ CTGACATTTGTAACGGTGAGAGGTGCAGGCCATCTCGTACCTCTCAATAAACCGAGTGAA
rJMSF012C19+ CTGACATTTGTAACGGTGAGAGGTGCAGGCCATCTCGTACCTCTCAATAAACCGAGTGAA
rJMSF052I16+ CTGACATTTGTAACGGTGAGAGGTGCAGGCCATCTCGTACCTCTCAATAAACCGAGTGAA
rJMSF019E23+ CTGACATTTGTAACGGTGAGAGGTGCAGGCCATCTCGTACCTCTCAATAAACCGAGTGAA
                      ____________________________________________________________
consensus CTGACATTTGTAACGGTGAGAGGTGCAGGCCATCTCGTACCTCTCAATAAACCGAGTGAA
 
. : . : . : . : . : . :
rJMSF023H19+ GCTCTAGCTTTGATACATTCTTTCTTGTCCGGTGAAGAACTCCCAGCGCAGAGATGAACA
rJMSF012C19+ GCTCCAGCTTTGATACATTCTTTCTTGTCCGGTGAAGAACTCCCAGCGCAGAGATGAACA
rJMSF052I16+ GCTCTAGCTTTGATACATTCTTTCTTGTCCGGTGAAGAACTCCCAGCGCAGAGATGAACA
rJMSF019E23+ GCTCTAGCTTTGATACATTCTTTCTTGTCCGGTGAAGAACTCCCAGCGCAGAGATGAACA
                      ____________________________________________________________
consensus GCTCTAGCTTTGATACATTCTTTCTTGTCCGGTGAAGAACTCCCAGCGCAGAGATGAACA
 
. : . : . : . : . : . :
rJMSF023H19+ TCATCGCGCTCTTAGATTCGTTCGTATACTTGTATCAATTCGAAGAAATTCAGGAGCCCT
rJMSF012C19+ TCATCGCGCTCTTAGATTCGTTCGTATACTTGTATCAATTCGAAGAAATTCAGGAGCCCT
rJMSF052I16+ TCATCGCGCTCTTAGATTCGTTCGTATACTTGTATCAATTCGAAGAAATTCAGGAGCCCT
rJMSF019E23+ TCATCGCGCTCTTAGATTCGTTCGTATACTTGTATCAATTCGAAGAAATTCAGGAGCCCT
                      ____________________________________________________________
consensus TCATCGCGCTCTTAGATTCGTTCGTATACTTGTATCAATTCGAAGAAATTCAGGAGCCCT
 
. : . : . : . : . : . :
rJMSF023H19+ AAACACCAGAATACTAGCTCAAACAGTTAACAGCATTGTGTAGTTCATGTTTGTGTAGCC
rJMSF012C19+ AAACACCAGAATACTAGCTCAAACAGTTAACAGCATTGTGTAGTTCATGTTTGTGTAGCC
rJMSF052I16+ AAACACCAGAATACTAGCTCAAACAGTTAACAGCATTGTGTAGTTCATGTTTGTGTAGCC
rJMSF019E23+ AAACACCAGAATACTAGCTCAAACAGTTAACAGCATTGTGTAGTTCATGTTTGTGTAGCC
                      ____________________________________________________________
consensus AAACACCAGAATACTAGCTCAAACAGTTAACAGCATTGTGTAGTTCATGTTTGTGTAGCC
 
. : . : . : . : . : . :
rJMSF023H19+ AGAGAGTTGAATAATTTCTTCTCAACCCAAAGAAAGCTACAGACTTTTCTTCTTTCTTGC
rJMSF012C19+ AGAGAGTTGAATAATTTCTTCTCAACCCAAAGAAAGCTACAGACTTTTCTTCTTTCTTGC
rJMSF052I16+ AGAGAGTTGAATAATTTCTTCTCAACCCAAAGAAAGCTACAGACTTTTCTTCTTTCTTGC
rJMSF019E23+ AGAGAGTTGAATAATTTCTTCTCAACCCAAAGAAAGCTACAGACTTTTCTTCTTTCTTGC
                      ____________________________________________________________
consensus AGAGAGTTGAATAATTTCTTCTCAACCCAAAGAAAGCTACAGACTTTTCTTCTTTCTTGC
 
. : . : . : . : . : . :
rJMSF023H19+ TATTTATTGTTTCTGTGATGAACAAAACTTGTTCTGTTGTACTAATAAGATAAGGATTT
rJMSF012C19+ TATTTATTGTTTCTGTGATGAACAAAACTTGTTCTGTTGTACTAATAAGATAAGGATTT
rJMSF052I16+ TATTTATTGTTTCTGTGATGAACAAAACTTGTTCTGTTGTACTAATAAGATAAGGATTT
rJMSF019E23+ TATTTATTGTTTCTGTGATGAACAAAACTTGTTCTGTTGTACTAATAAGATAAGGATTTT
                      ____________________________________________________________
consensus TATTTATTGTTTCTGTGATGAACAAAACTTGTTCTGTTGTACTAATAAGATAAGGATTTT