Previous Contig 012066:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF019D14Sequence380005320 (7)735012066 (4)pir|G84578|G845782e-13probable potassium/proton antiporter [imported] - Arabidopsis thaliana>gb:AC0059
JMSF036O08Sequence656005320 (7)pir|G84578|G845784e-31probable potassium/proton antiporter [imported] - Arabidopsis thaliana>gb:AC0059673012066 (4)pir|G84578|G845785e-14probable potassium/proton antiporter [imported] - Arabidopsis thaliana>gb:AC0059
JMSF041A13Sequence693005320 (7)pir|G84578|G845781e-37probable potassium/proton antiporter [imported] - Arabidopsis thaliana>gb:AC0059558012066 (4)pir|G84578|G845782e-08probable potassium/proton antiporter [imported] - Arabidopsis thaliana>gb:AC0059
JMSF050J10Sequence641005320 (7)pir|G84578|G845783e-27probable potassium/proton antiporter [imported] - Arabidopsis thaliana>gb:AC0059727012066 (4)pir|G84578|G845784e-15probable potassium/proton antiporter [imported] - Arabidopsis thaliana>gb:AC0059

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF036O08+ ACTCAGTCGTGCATC
rJMSF050J10+ TTTTGTGTTACTCAGTCGTGCATC
rJMSF019D14+ ACTCAGTCGTGCATC
                      ____________________________________________________________
consensus TTTTGTGTTACTCAGTCGTGCATC
 
. : . : . : . : . : . :
rJMSF036O08+ AAACCTTCATCTTGTCGAGGGGAAACTGTATCTTCTGCTTCTTGGTACAACAGCTCTTAG
rJMSF050J10+ AAACCTTCATCTTGTCGAGGGGAAACTGTATCTTCTGCTTCTTGGTACAACAGCTCTTAG
rJMSF019D14+ AAACCTTCATCTTGTCGAGGGGAAACTGTATCTTCTGCTTCTTGGTACAACAGCTCTTAG
                      ____________________________________________________________
consensus AAACCTTCATCTTGTCGAGGGGAAACTGTATCTTCTGCTTCTTGGTACAACAGCTCTTAG
 
. : . : . : . : . : . :
rJMSF036O08+ TCTGGTGACTACTCCATTGCTTTTTAAGCTAATACCTGCTGTGGTGCACCTTGGGGTGCT
rJMSF050J10+ TCTGGTGACTACTCCATTGCTTTTTAAGCTAATACCTGCTGTGGTGCACCTTGGGGTGCT
rJMSF041A13+ CCTGCTGTGGTGCACCTTGGGGTGCT
rJMSF019D14+ TCTGGTGACTACTCCATTGCTTTTTAAGCTAATACCTGCTGTGGTGCACCTTGGGGTGCT
                      ____________________________________________________________
consensus TCTGGTGACTACTCCATTGCTTTTTAAGCTAATACCTGCTGTGGTGCACCTTGGGGTGCT
 
. : . : . : . : . : . :
rJMSF036O08+ GCTTAGGTGGTTTTCACCTGACAGCCAAACTGAGTTGGGGTTAAAAGGAGAAACCCTCCG
rJMSF050J10+ GCTTAGGTGGTTTTCACCTGACAGCCAAACTGAGTTGGGGTTAAAAGGAGAAACCCTCCG
rJMSF041A13+ GCTTAGGTGGTTTTCACCTGACAGCCAAACTGAGTTGGGGTTAAAAGGAGAAACCCTCCG
rJMSF019D14+ GCTTAGGTGGTTTTCACCTGACAGCCAAACTGAGTTGGGGTTAAAAGGAGAAACCCTCCG
                      ____________________________________________________________
consensus GCTTAGGTGGTTTTCACCTGACAGCCAAACTGAGTTGGGGTTAAAAGGAGAAACCCTCCG
 
. : . : . : . : . : . :
rJMSF036O08+ ATCAGAGAGTGTTAAGCAAAGGATTGCCTTGATATCCAAGGATCTCTTGATTCACGAGGG
rJMSF050J10+ ATCAGAGAGTGTTAAGCAAAGGATTGCCTTGATATCCAAGGATCTCTTGATTCACGAGGG
rJMSF041A13+ ATCAGAGAGTGTTAAGCAAAGGATTGCCTTGATATCCAAGGATCTCTTGATTCACGAGGG
rJMSF019D14+ ATCAGAGAGTGTTAAGCAAAGGATTGCCTTGATATCCAAGGATCTCTTGATTCACGAGGG
                      ____________________________________________________________
consensus ATCAGAGAGTGTTAAGCAAAGGATTGCCTTGATATCCAAGGATCTCTTGATTCACGAGGG
 
. : . : . : . : . : . :
rJMSF036O08+ GTAAACTAGTGAAGCTAGATGCCACATATGCCCGGGGACAACAAAAAGGCTACATTCCCA
rJMSF050J10+ GTAAACTAGTGAAGCTAGATGCCACATATGCCCGGGGACAACAAAAAGGCTACATTCCCA
rJMSF041A13+ GTAAACTAGTGAAGCTAGATGCCACATATGCCCGGGGACAACAAAAAGGCTACATTCCCA
rJMSF019D14+ GTAAACTAGTGAAGCTAGATGCCACATATGCCCGGGGACAACAAAAAGGCTACATTCCCA
                      ____________________________________________________________
consensus GTAAACTAGTGAAGCTAGATGCCACATATGCCCGGGGACAACAAAAAGGCTACATTCCCA
 
. : . : . : . : . : . :
rJMSF036O08+ GCTCAATTTTTAGTATATGCACTTGGGATTCCTGCTCAATTCAACCAAGCTTGCTTTACG
rJMSF050J10+ GCTCAATTTTTAGTATATGCACTTGAGATTCCTGCTCAATTCAACCAAGCTTGCTTTACG
rJMSF041A13+ GCTCAATTTTTAGTATATGCACTTGAGATTCCTGCTCAATTCAACCAAGCTTGCTTTACG
rJMSF019D14+ GCTCAATTTTTAGTATATGCACTTGAGATTCCTGCTCAATTCAACCAAGCTTGCTTTACG
                      ____________________________________________________________
consensus GCTCAATTTTTAGTATATGCACTTGAGATTCCTGCTCAATTCAACCAAGCTTGCTTTACG
 
. : . : . : . : . : . :
rJMSF036O08+ TTGTGCTATATACTTCAGCTTAGACTTAGAGAGAAGGGAGTGGCAACAACCTCTGAAAAT
rJMSF050J10+ TTGTGCTATATACTTCAGCTTAGACTTAGAGAGAAGGGAGTGGCAACAACCTCTGAAAAT
rJMSF041A13+ TTGTGCTATATACTTCAGCTTAGACTTAGAGAGAAGGGAGTGGCAACAACCTCTGAAAAT
rJMSF019D14+ TTGTGCTATATACTTCAGCTTAGACTTAGAGAGAAGGGAGTGGCAACAACCTCTGAAAAT
                      ____________________________________________________________
consensus TTGTGCTATATACTTCAGCTTAGACTTAGAGAGAAGGGAGTGGCAACAACCTCTGAAAAT
 
. : . : . : . : . : . :
rJMSF036O08+ GGGAAACCACAATTGGAGGTTTTCTAACTCTGACAGAACCACTAACAAGATGAAGGCATT
rJMSF050J10+ GGGAAACCACAATTGGAGGTTTTCTAACTCTGACAGAACCACTAACAAGATGAAGGCATT
rJMSF041A13+ GGGAAACCACAATTGGAGGTTTTCTAACTCTGACAGAACCACTAACAAGATGAAGGCATT
rJMSF019D14+ GGGAAACCACAATTGGAGGTTTTCTAACTCTGACAGAACCACTAACAAGATGAAGGCATT
                      ____________________________________________________________
consensus GGGAAACCACAATTGGAGGTTTTCTAACTCTGACAGAACCACTAACAAGATGAAGGCATT
 
. : . : . : . : . : . :
rJMSF036O08+ CGCATTCGCATTTAACCAAGGTAATTTTGATTTTTCTTTTTCCTCTTGTCATTCTTTTTC
rJMSF050J10+ CGCATTCGCATTTAACCAAGGTAATTTTGATTTTTCTTTTTCCTCTTGTCATTCTTTTTC
rJMSF041A13+ CGCATTCGCATTTAACCAAGGTAATTTTGATTTTTCTTTTTCCTCTTGTCATTCTTTTTC
rJMSF019D14+ CGCATTCGCATTTAACCAAGGTAATTTTGATTTTTCTTTTTCCTCTTGTCATTCTTTTTC
                      ____________________________________________________________
consensus CGCATTCGCATTTAACCAAGGTAATTTTGATTTTTCTTTTTCCTCTTGTCATTCTTTTTC
 
. : . : . : . : . : . :
rJMSF036O08+ ATTTTTTGCTAGTGTAAAATAGTTTTTGGTTTGTGATGTGTAGTGAATTTTGTGCAACCG
rJMSF050J10+ ATTTTTTGCTAGTGTAAAATAGTTTTTGGTTTGTGATGTGTAGTGAATTTTGTGCAACCG
rJMSF041A13+ ATTTTTTGCTAGTGTAAAATAGTTTTTGGTTTGTGATGTGTAGTGAATTTTGTGCAACCG
rJMSF019D14+ ATTTTTTGCTAGTGTAAAATAGTTTTTGGTTTGTGATGTGTAGTGAATTTTGTGCAACCG
                      ____________________________________________________________
consensus ATTTTTTGCTAGTGTAAAATAGTTTTTGGTTTGTGATGTGTAGTGAATTTTGTGCAACCG
 
. : . : . : . : . : . :
rJMSF036O08+ CATTTGGTTATGTATGTTTGTTCTGTAGATTCTAGAATGTAACAAAAAACATT
rJMSF050J10+ CATTTGGTTATGTATGTTTGTTCTGTAGATTCTAGAATGTAACAAAAAACATTTTCTAGC
rJMSF041A13+ CATTTGGTTATGTATGTTTGTTCTGTAGATTCTAGAATG-AACAAAAAACATT
rJMSF019D14+ CATTTGGTTATGTATGTTTGTTCTGTAGATTCTAGAATGTAACAAAAAACATTTTCTAGC
                      ____________________________________________________________
consensus CATTTGGTTATGTATGTTTGTTCTGTAGATTCTAGAATGTAACAAAAAACATTTTCTAGC
 
. : . : . : . : . : . :
rJMSF050J10+ CTGTTATTCGATGTCAATTGTATAGAAGTGCCATCTCTCAGTA
rJMSF019D14+ CTGTTATTCGATGTCAATTGTATAGAAGTGCCATCTCTCAGTACTTTCTATTCTGAAAAT
                      ____________________________________________________________
consensus CTGTTATTCGATGTCAATTGTATAGAAGTGCCATCTCTCAGTACTTTCTATTCTGAAAAT