Previous Contig 012065:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF019D07Sequence451005804 (2)gb:AF195548_17758804e-48Arabidopsis thaliana putative histone deacetylase (RPD3B) mRNA, complete cds.760012065 (2)gb:AB008265_15103943e-55Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MDC12.>gb:AY072201_1567
JMSF022O14Sequence690005804 (2)gb:AF195548_17758804e-91Arabidopsis thaliana putative histone deacetylase (RPD3B) mRNA, complete cds.724012065 (2)gb:AB008265_15103943e-48Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MDC12.>gb:AY072201_1567

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF022O14+ TGGT
rJMSF019D07+ TCTCAGATCTTTTAACGTTCCTTTAATGGTCTTGGGTGGT
                      ____________________________________________________________
consensus TCTCAGATCTTTTAACGTTCCTTTAATGGTCTTGGGTGGT
 
. : . : . : . : . : . :
rJMSF022O14+ GGAGGGTATACAATTCGAAATGNTGCCCGGTGCTGGTGCTATGAGACAGCAGTAGCAGTG
rJMSF019D07+ GGAGGGTATACAATTCGAAATGTTGCCCGGTGCTGGTGCTATGAGACAGCAGTAGCAGTG
                      ____________________________________________________________
consensus GGAGGGTATACAATTCGAAATGTTGCCCGGTGCTGGTGCTATGAGACAGCAGTAGCAGTG
 
. : . : . : . : . : . :
rJMSF022O14+ GGGGTTGAACCTGATAATAAATTGCCTTATAACGAGTACTATGAATATTTTGGTCCTGAT
rJMSF019D07+ GGGGTTGAACCTGATAATAAATTGCCTTATAACGAGTACTATGAATATTTTGGTCCTGAT
                      ____________________________________________________________
consensus GGGGTTGAACCTGATAATAAATTGCCTTATAACGAGTACTATGAATATTTTGGTCCTGAT
 
. : . : . : . : . : . :
rJMSF022O14+ TATACACTTCATGTTGAACCACATCCCATGGAGAATCAGAACTCACCACGGGATTTGGAG
rJMSF019D07+ TATACACTTCATGTTGAACCACATCCCATGGAGAATCAGAACTCACCACGGGATTTGGAG
                      ____________________________________________________________
consensus TATACACTTCATGTTGAACCACATCCCATGGAGAATCAGAACTCACCACGGGATTTGGAG
 
. : . : . : . : . : . :
rJMSF022O14+ AAGATCAGGAATATGCTGCTCGAACAACTTTCTGAATTGCCACATGCACCAAGTGTTCCA
rJMSF019D07+ AAGATCAGGAATATGCTGCTCGAACAACTTTCTGAATTGCCACATGCACCAAGTGTTCCA
                      ____________________________________________________________
consensus AAGATCAGGAATATGCTGCTCGAACAACTTTCTGAATTGCCACATGCACCAAGTGTTCCA
 
. : . : . : . : . : . :
rJMSF022O14+ TTCCAGATGACTCCTTCCACTATTGAAGTTCCGGAAGAGAGAGAGGAAGATATGGATCAG
rJMSF019D07+ TTCCAGATGACTCCTTCCACTATTGAAGTTCCGGAAGAGAGAGAGGAAGATATGGATCAG
                      ____________________________________________________________
consensus TTCCAGATGACTCCTTCCACTATTGAAGTTCCGGAAGAGAGAGAGGAAGATATGGATCAG
 
. : . : . : . : . : . :
rJMSF022O14+ AGACGTAACCCCCGGATTTGGAATGGCGATGAATATTTTTCCGATGGTGAGGAAGATGAA
rJMSF019D07+ AGACGTAACCCCCGGATTTGGAATGGCGATGAATATTTTTCCGATGGTGAGGAAGATGAA
                      ____________________________________________________________
consensus AGACGTAACCCCCGGATTTGGAATGGCGATGAATATTTTTCCGATGGTGAGGAAGATGAA
 
. : . : . : . : . : . :
rJMSF022O14+ AAGCCTCGTCTACGAAGAAGTTCTGATGCTAATATGACGCCCAAGAGAAACTCTAACATG
rJMSF019D07+ AAGCCTCGTCTACGAAGAAGTTCTGATGCTAATATGACGCCCAAGAGAAACTCTAACATG
                      ____________________________________________________________
consensus AAGCCTCGTCTACGAAGAAGTTCTGATGCTAATATGACGCCCAAGAGAAACTCTAACATG
 
. : . : . : . : . : . :
rJMSF022O14+ AGGGAGTACTTTGATGGAATGGATGATAAAGACATGATCGATGCAGATAACTAGTGCAGT
rJMSF019D07+ AGGGAGTACTTTGATGGAATGGATGATAAAGACATGATCGATGCAGATAACTAGTGCAGT
                      ____________________________________________________________
consensus AGGGAGTACTTTGATGGAATGGATGATAAAGACATGATCGATGCAGATAACTAGTGCAGT
 
. : . : . : . : . : . :
rJMSF022O14+ GCTCCGTCCATTAAGAAAACCTTCACCCGGCAAAGTTTCTTACCAAGTAGCGCAAGCTGA
rJMSF019D07+ GCTCCGTCCATTAAGAAAACCTTCACCCGGCAAAGTTTCTTACCAAGTAGCGCAAGCTGA
                      ____________________________________________________________
consensus GCTCCGTCCATTAAGAAAACCTTCACCCGGCAAAGTTTCTTACCAAGTAGCGCAAGCTGA
 
. : . : . : . : . : . :
rJMSF022O14+ CAATTTGTGGTGGCTGAAAACTTTTCCCAGCTCACAATCAATTTTATTCGATCGGTACTT
rJMSF019D07+ CAATTTGTGGTGGCTGAAAACTTTTCCCAGCTCACAATCAATTTTATTCGATCGGTACTT
                      ____________________________________________________________
consensus CAATTTGTGGTGGCTGAAAACTTTTCCCAGCTCACAATCAATTTTATTCGATCGGTACTT
 
. : . : . : . : . : . :
rJMSF022O14+ ATCCTAGAAGTTGAAGAAACTATAGATAGTAAATAGGAAGACTTAGAGATATCTAGTTTA
rJMSF019D07+ ATCCTAGAAGTTGAAGAAACTATAGATAGTAAATAGGAAGACTTAGAGATATCTAGTTTA
                      ____________________________________________________________
consensus ATCCTAGAAGTTGAAGAAACTATAGATAGTAAATAGGAAGACTTAGAGATATCTAGTTTA
 
. : . : . : . : . : . :
rJMSF022O14+ ATTTGAACATGTTTCTTGCAATGCTTTATGTGAGATATGATCACTGTAATGTAAACATTT
rJMSF019D07+ ATTTGAACATGTTTCTTGCAATGCTTTATGTGAGATATGATCACTGTAATGTAAACATTT
                      ____________________________________________________________
consensus ATTTGAACATGTTTCTTGCAATGCTTTATGTGAGATATGATCACTGTAATGTAAACATTT