Previous Contig 012058:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001N22Sequence286004640 (7)gb:AB009049_15106016e-19Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCD7.>gb:AY054551_15632775012058 (5)sp|Q42954|KPYC_TOBAC1e-88Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK).>pir|S41379|S41379 pyruvat
JMSF004L19Sequence337004640 (7)sp|Q42954|KPYC_TOBAC4e-27Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK).>pir|S41379|S41379 pyruvat344012058 (5)
JMSF018E21Sequence229004640 (7)sp|Q42954|KPYC_TOBAC9e-07Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK).>pir|S41379|S41379 pyruvat743012058 (5)sp|Q42954|KPYC_TOBAC2e-67Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK).>pir|S41379|S41379 pyruvat
JMSF019C01Sequence356004640 (7)sp|Q42954|KPYC_TOBAC6e-31Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK).>pir|S41379|S41379 pyruvat792012058 (5)sp|Q42954|KPYC_TOBAC2e-70Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK).>pir|S41379|S41379 pyruvat
JMSF047F05Sequence711004640 (7)sp|Q42954|KPYC_TOBAC2e-92Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK).>pir|S41379|S41379 pyruvat756012058 (5)sp|Q42954|KPYC_TOBACe-100Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK).>pir|S41379|S41379 pyruvat

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF047F05+ CACGGCNACCCAGATGTTGGAATCGATGATCAAGTCTCCAAG
                      ____________________________________________________________
consensus CACGGCNACCCAGATGTTGGAATCGATGATCAAGTCTCCAAG
 
. : . : . : . : . : . :
rJMSF047F05+ GCCAACTCGTGCAGAAGCAACAGATGTTGCCAATGCCGTTCTTGATGGGACAGACTGTGT
rJMSF001N22+ TGCAGNAGCAACAGATGTTGCCAATGCCGTTCTTGATGGGACAGACTGTGT
                      ____________________________________________________________
consensus GCCAACTCGTGCAGAAGCAACAGATGTTGCCAATGCCGTTCTTGATGGGACAGACTGTGT
 
. : . : . : . : . : . :
rJMSF047F05+ GATGCTTAGTGGTGAAACAGCTGCAGGGGCTTATCCAGATCTTGCAGTACGTACGATGGC
rJMSF001N22+ GATGCTTAGTGATGAAACAGCTGCAGGGGCTTATCCAGATCTTGCAGTACGTACGATGGC
rJMSF019C01+ TACGTACGATGGC
                      ____________________________________________________________
consensus GATGCTTAGTGGTGAAACAGCTGCAGGGGCTTATCCAGATCTTGCAGTACGTACGATGGC
 
. : . : . : . : . : . :
rJMSF047F05+ CAAAATTTGCATAGAAGCAGAGAGCACAATTGATTATGCAGATGTGTTCAAAAGAATCGT
rJMSF001N22+ CAAAATTTGCATAGAAGCAGAGAGCACAATTGATTATGCAGATGTGTTCAAAAGAATCGT
rJMSF018E21+ CATAGAAGCAGAGAGCACAATTGATTATGCAGATGTGTTCAAAAGAATCGT
rJMSF019C01+ CAAAATTTGCATAGNAGCAGAGAGCACAATTGATTATGCAGATGTGTTCAAAAGAATCGT
                      ____________________________________________________________
consensus CAAAATTTGCATAGAAGCAGAGAGCACAATTGATTATGCAGATGTGTTCAAAAGAATCGT
 
. : . : . : . : . : . :
rJMSF047F05+ GGCAAGCGCACCAGTTCCTATGAGCCCACTAGAGAGTCTTGCATCTTCTGCTGTCCGAAC
rJMSF001N22+ GGCAAGCGCACCAGTTCCTATGAGCCCACTAGAGAGTCTTGCATCTTCTGCTGTCCGAAC
rJMSF018E21+ GGCAAGCGCACCAGTTCCTATGAGCCCACTAGAGAGTCTTGCATCTTCTGCTGTCCGAAC
rJMSF019C01+ GGCAAGCGCACCAGTTCCTATGAGCCCACTAGAGAGTCTTGCATCTTCTGCTGTCCGAAC
                      ____________________________________________________________
consensus GGCAAGCGCACCAGTTCCTATGAGCCCACTAGAGAGTCTTGCATCTTCTGCTGTCCGAAC
 
. : . : . : . : . : . :
rJMSF047F05+ AGCTAACTCTGCTAATGCCTCTCTCATCCTTGTTCTGACCCGGGGAGGAAGTACTGCAAA
rJMSF001N22+ AGCTAACTCTGCTAATGCCTCTCTCATCCTTGTTCTGACCCGGGGAGGAAGTACTGCAAA
rJMSF018E21+ AGCTAACTCTGCTAATGCCTCTCTCATCCTTGTTCTGACCCGGGGAGGAAGTACTGCAAA
rJMSF019C01+ AGCTAACTCTGCTAATGCCTCTCTCATCCTTGTTCTGACCCGGGGAGGAAGTACTGCAAA
                      ____________________________________________________________
consensus AGCTAACTCTGCTAATGCCTCTCTCATCCTTGTTCTGACCCGGGGAGGAAGTACTGCAAA
 
. : . : . : . : . : . :
rJMSF047F05+ GCTGGTAGCCAAATACAGGCCGGGAAAGCCTATATTGTCAGTCGTCGTCCCTGAGATCAA
rJMSF001N22+ GCTGGTAGCCAAATACAGGCCGGGAAAGCCTATATTGTCAGTCGTCGTCCCTGAGATCAA
rJMSF018E21+ GCTGGTAGCCAAATACAGGCCGGGAAAGCCTATATTGTCAGTCGTCGTCCCTGAGATCAA
rJMSF019C01+ GCTGGTAGCCAAATACAGGCCGGGAAAGCCTATATTGTCAGTCGTCGTCCCTGAGATCAA
                      ____________________________________________________________
consensus GCTGGTAGCCAAATACAGGCCGGGAAAGCCTATATTGTCAGTCGTCGTCCCTGAGATCAA
 
. : . : . : . : . : . :
rJMSF047F05+ GACCGACTCCTTTGACTGGTCATGTAGCGAGGAGTACCCAGCAAGGCATAGCCTTATTTT
rJMSF001N22+ GACCGACTCCTTTGACTGGTCATGTAGCGAGGAGTACCCAGCAAGGCATAGCCTTATTTT
rJMSF018E21+ GACCGACTCCTTTGACTGGTCATGTAGCGAGGAGTACCCAGCAAGGCATAGCCTTATTTT
rJMSF019C01+ GACCGACTCCTTTGACTGGTCATGTAGCGAGGAGTACCCAGCAAGGCATAGCCTTATTTT
                      ____________________________________________________________
consensus GACCGACTCCTTTGACTGGTCATGTAGCGAGGAGTACCCAGCAAGGCATAGCCTTATTTT
 
. : . : . : . : . : . :
rJMSF047F05+ CAGGGGACTAGTCCCAGTCCTGTGTGCAGGATCTGCAAGAGCATCCCACGAGGAGTCGAC
rJMSF001N22+ CAGGGGACTAGTCCCAGTCCTGTGTGCAGGATCTGCAAGAGCATCCCACGAGGAGTCGAC
rJMSF018E21+ CAGGGGACTAGTCCCAGTCCTGTGTGCAGGATCTGCAAGAGCATCCCACGAGGAGTCGAC
rJMSF019C01+ CAGGGGACTAGTCCCAGTCCTGTGTGCAGGATCTGCAAGAGCATCCCACGAGGAGTCGAC
                      ____________________________________________________________
consensus CAGGGGACTAGTCCCAGTCCTGTGTGCAGGATCTGCAAGAGCATCCCACGAGGAGTCGAC
 
. : . : . : . : . : . :
rJMSF047F05+ AGAGGAGGCACTCGTGTTCTCCCTCCAACATGCCAAAGCAAAAGGATTATGTGAGGTAGG
rJMSF001N22+ AGAGGAGGCACTCGTGTTCTCCCTCCAACATGCCAAAGCAAAAGGATTATGTGAGGTAGG
rJMSF004L19+ AAAAGGATTATGTGAGGTAGG
rJMSF018E21+ AGAGGAGGCACTCGTGTTCTCCCTCCAACATGCCAAAGCAAAAGGATTATGTGAGGTAGG
rJMSF019C01+ AGAGGAGGCACTCGTGTTCTCCCTCCAACATGCCAAAGCAAAAGGATTATGTGAGGTAGG
                      ____________________________________________________________
consensus AGAGGAGGCACTCGTGTTCTCCCTCCAACATGCCAAAGCAAAAGGATTATGTGAGGTAGG
 
. : . : . : . : . : . :
rJMSF047F05+ AGATGCTGTCGTGGTCCTTCACCGCATTGGAACTGCTTCTGTGATCAAGATCGTGACAGT
rJMSF001N22+ AGATGCTGTCGTGGTCCTTCACCGCATTGGAACTGCTTCTGTGATCAAGATCGTGACAGT
rJMSF004L19+ AGATGCTGTCNTGGTCCTTCACCGCATNGGAACTGCTTCTGTGATCAAGATCGTGACAGT
rJMSF018E21+ AGATGCTGTCGTGGTCCTTCACCGCATTGGAACTGCTTCTGTGATCAAGATCGTGACAGT
rJMSF019C01+ AGATGCTGTCGTGGTCCTTCACCGCATTGGAACTGCTTCTGTGATCAAGATCGTGACAGT
                      ____________________________________________________________
consensus AGATGCTGTCGTGGTCCTTCACCGCATTGGAACTGCTTCTGTGATCAAGATCGTGACAGT
 
. : . : . : . : . : . :
rJMSF047F05+ GAAGTAAGTGATTGAGTAATATACCAACTTGGTTGTGGAGAAGCAAACATTATATTCACT
rJMSF001N22+ GAAGTAAGTGATTGAGTAATATACCAACTTGGTTGTGGAGAAGCAAACATTATATTCACT
rJMSF004L19+ GAAGTAAGTGATTGAGTAATATACCAACTTGGTTGTGGAGAAGCAAACATTATATTCACT
rJMSF018E21+ GAAGTAAGTGATTGAGTAATATACCAACTTGGTTGTGGAGAAGCAAACATTATATTCACT
rJMSF019C01+ GAAGTAAGTGATTGAGTAATATACCAACTTGGTTGTGGAGAAGCAAACATTATATTCACT
                      ____________________________________________________________
consensus GAAGTAAGTGATTGAGTAATATACCAACTTGGTTGTGGAGAAGCAAACATTATATTCACT
 
. : . : . : . : . : . :
rJMSF047F05+ TTTCACTCTCTTTTGTTAAATCAGATTTTTTTGTTCTGCTTTTTAATTT
rJMSF001N22+ TTTCACTCTCTTTTGTTAAATCAGATTTTTTTGTTCTGCTTTTTAATTTTAACTTTCCAC
rJMSF004L19+ TTTCACTNTCTTTTGTTAAATCAGATTTTTTTGTTNTGCTTTTTAATTTTAACTTTCCAC
rJMSF018E21+ TTTCACTCTCTTTTGTTAAATCAGATTTTTTTGTTCTGCTTTTTAATTTTAACTTTCCAC
rJMSF019C01+ TTTCACTCTCTTTTGTTAAATCAGATTTTTTTGTTCTGCTTTTTAATTTTAACTTTCCAC
                      ____________________________________________________________
consensus TTTCACTCTCTTTTGTTAAATCAGATTTTTTTGTTCTGCTTTTTAATTTTAACTTTCCAC
 
. : . : . : . : . : . :
rJMSF001N22+ AAGGGACACCACTATACGCCCTATTGCACCCTTCTTCTAGAAACCATGTTTTGCGCCAGC
rJMSF004L19+ AAGGGACACCACTATACGCCCTATTGCACCCTTCTTCTAGAAACCATGTTTTGCGCCAGC
rJMSF018E21+ AAGGGACACCACTATACGCCCTATTGCACCCTTCTTCTAGAAACCATGTTTTGCGCCAGC
rJMSF019C01+ AAGGGACACCACTATACGCCCTATTGCACCCTTCTTCTAGAAACCATGTTTTGCGCCAGC
                      ____________________________________________________________
consensus AAGGGACACCACTATACGCCCTATTGCACCCTTCTTCTAGAAACCATGTTTTGCGCCAGC
 
. : . : . : . : . : . :
rJMSF001N22+ CAAT
rJMSF004L19+ CAATTTTCCAACCTCACAAAGCTGAATCCTGAAAGCTGGATTATTATTTTGCTATATCTT
rJMSF018E21+ CAATTTTCCAACCTCACAAAGCTGAATCCTGAAAGCTGGATTATTATTTTGCTATATCTT
rJMSF019C01+ CAATTTTCCAACCTCACAAAGCTGAATCCTGAAAGCTGGATTATTATTTTGCTATATCTT
                      ____________________________________________________________
consensus CAATTTTCCAACCTCACAAAGCTGAATCCTGAAAGCTGGATTATTATTTTGCTATATCTT
 
. : . : . : . : . : . :
rJMSF004L19+ TNTGTTGAGTGAAGTANTAAAC
rJMSF018E21+ TTTGTTGATTGAAGTATTAAACCAGTAGAATA
rJMSF019C01+ TTTGTTGATTGAAGTATTAAA-CAGTAGAATAATGAATTGTTAAAGATGAGTGAAAGTGA
                      ____________________________________________________________
consensus TTTGTTGATTGAAGTATTAAACCAGTAGAATAATGAATTGTTAAAGATGAGTGAAAGTGA