Previous Contig 012057:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS116C06Sequence554012057 (2)gb:AB015472_15125297e-82Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAE1.>gb:AY140066_15825
JMSF019B11Sequence531003101 (5)gb:AJ879065_18151262e-48Capsicum chinense partial mRNA for ABC transporter protein.706012057 (2)gb:AP004587_18419699e-44Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P054

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS116C06- TTAGTTCCGACTGATGGTATGG
                      ____________________________________________________________
consensus TTAGTTCCGACTGATGGTATGG
 
. : . : . : . : . : . :
JMFS116C06- TCCGACGCCATAATCATCTTAAAATTGCACAGTATCATCAACACTTGGCTGAGAAACTCG
                      ____________________________________________________________
consensus TCCGACGCCATAATCATCTTAAAATTGCACAGTATCATCAACACTTGGCTGAGAAACTCG
 
. : . : . : . : . : . :
JMFS116C06- ACATGGAAATGTCTGCCCTTCTGTACATGATCAGAGAGTATCCTGGCAATGAGGAAGAGA
                      ____________________________________________________________
consensus ACATGGAAATGTCTGCCCTTCTGTACATGATCAGAGAGTATCCTGGCAATGAGGAAGAGA
 
. : . : . : . : . : . :
JMFS116C06- AAATGAGGGCAGCAATTGGTAGGTTTGGTCTGACTGGTAAAGCTCAGATAATGCCTATGA
                      ____________________________________________________________
consensus AAATGAGGGCAGCAATTGGTAGGTTTGGTCTGACTGGTAAAGCTCAGATAATGCCTATGA
 
. : . : . : . : . : . :
JMFS116C06- AGAACTTGTCGGATGGGCAACGCAGCCGGGTGGTATTTGCATGGTTAGCTTTTAGGCAGC
rJMSF019B11+ CAACGTAGCCGGGTGGTTTTTGCATGGTTAGCTTTTAGGCAGC
                      ____________________________________________________________
consensus AGAACTTGTCGGATGGGCAACGTAGCCGGGTGGTTTTTGCATGGTTAGCTTTTAGGCAGC
 
. : . : . : . : . : . :
JMFS116C06- CTCACATGCTACTGCTGGACGAGCCAACCAACCATTTGGATATTGAGACTATTGACTCAC
rJMSF019B11+ CTCACCTATTACTGTTGGACGAGCCAACCAACCATCTGGATATTGAGACTATTGACTCAC
                      ____________________________________________________________
consensus CTCACCTGTTACTGTTGGACGAGCCAACCAACCATTTGGATATTGAGACTATTGACTCAC
 
. : . : . : . : . : . :
JMFS116C06- TGGCGGAAGCTTTGAATGAGTGGGATGGGGGTATGGTTCTTGTTAGCCATGATTTTAGGC
rJMSF019B11+ TAGCAGATGCCTTGAATGAATGGGATGGTGGGATGGTTCTTGTTAGCCATGATTTCAGGC
                      ____________________________________________________________
consensus TGGCGGATGCTTTGAATGAGTGGGATGGTGGTATGGTTCTTGTTAGCCATGATTTTAGGC
 
. : . : . : . : . : . :
JMFS116C06- TCATCAACCAGGTTGCCC
rJMSF019B11+ TCATAAACCAGGTCGCCCGCGAGATATGGGTCTGCGAAAACCAGGCTGTTACCAAGTGGG
                      ____________________________________________________________
consensus TCATCAACCAGGTTGCCCGCGAGATATGGGTCTGCGAAAACCAGGCTGTTACCAAGTGGG
 
. : . : . : . : . : . :
rJMSF019B11+ AGGGTGACATTATGGACTTTAAGCGACACTTGAAAAGCAATGCAGGTCTAGGCGATTGAA
                      ____________________________________________________________
consensus AGGGTGACATTATGGACTTTAAGCGACACTTGAAAAGCAATGCAGGTCTAGGCGATTGAA
 
. : . : . : . : . : . :
rJMSF019B11+ GCAAACCATGCCAAGTCTCAATTTTAAAGAGTGAGCCATTCCCCTCGGCCTATACTTCCA
                      ____________________________________________________________
consensus GCAAACCATGCCAAGTCTCAATTTTAAAGAGTGAGCCATTCCCCTCGGCCTATACTTCCA
 
. : . : . : . : . : . :
rJMSF019B11+ GGCCCACTGGTAACATCATCAAAAAGCGGTTTCTTTTATAAGATTTTGATTAAATCTTGG
                      ____________________________________________________________
consensus GGCCCACTGGTAACATCATCAAAAAGCGGTTTCTTTTATAAGATTTTGATTAAATCTTGG
 
. : . : . : . : . : . :
rJMSF019B11+ AAGAGGTGCCCCTATCTCTGCACTCCGCTCTCCAGGTGATTAGTTTAGTATGCTTAAATT
                      ____________________________________________________________
consensus AAGAGGTGCCCCTATCTCTGCACTCCGCTCTCCAGGTGATTAGTTTAGTATGCTTAAATT
 
. : . : . : . : . : . :
rJMSF019B11+ TCTATTTCAGTTTATGATACTCATTCACCGGGGGAGAGCGTTAAACATGGCAGATGCCAG
                      ____________________________________________________________
consensus TCTATTTCAGTTTATGATACTCATTCACCGGGGGAGAGCGTTAAACATGGCAGATGCCAG
 
. : . : . : . : . : . :
rJMSF019B11+ TTTCTGAGCTGTGTTAACAATAGTGCTTCCCATAGTATTATTATCCGTGACTTCTGGATT
                      ____________________________________________________________
consensus TTTCTGAGCTGTGTTAACAATAGTGCTTCCCATAGTATTATTATCCGTGACTTCTGGATT
 
. : . : . : . : . : . :
rJMSF019B11+ GTTACCTTGACCAAAACTAAATCAAAATACCATGTTCTTATGAATTTTGCCCTTTAATTT
                      ____________________________________________________________
consensus GTTACCTTGACCAAAACTAAATCAAAATACCATGTTCTTATGAATTTTGCCCTTTAATTT
 
. : . : . : . : . : . :
rJMSF019B11+ TGCATTTTTGCCTCTTGAGTTGTAATTTCGAACCAGAATGTTTTATACCAGTGAATGAAT
                      ____________________________________________________________
consensus TGCATTTTTGCCTCTTGAGTTGTAATTTCGAACCAGAATGTTTTATACCAGTGAATGAAT