Previous Contig 012042:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF018N07Sequence441005775 (2)gb:AF292397_17837711e-26Arabidopsis thaliana POZ/BTB containing-protein AtPOB1 mRNA, complete cds.738012042 (2)gb:AY084542_15696318e-81Arabidopsis thaliana clone 111153 mRNA, complete sequence.
JMSF022K01Sequence677005775 (2)gb:AF292397_17837714e-56Arabidopsis thaliana POZ/BTB containing-protein AtPOB1 mRNA, complete cds.754012042 (2)gb:AF292397_17837713e-82Arabidopsis thaliana POZ/BTB containing-protein AtPOB1 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF022K01+ ATCGGCAGCGAACCCAAGCTGCAGAGGGATCTACT
rJMSF018N07+ AGCTGCAGAGGGATCTACT
                      ____________________________________________________________
consensus ATCGGCAGCGAACCCAAGCTGCAGAGGGATCTACT
 
. : . : . : . : . : . :
rJMSF022K01+ TCCGCAAGTCGTCGCTTTGTTGAGCGTGCTTACAAGTATCGACCTATCAAGGTAGTGGAG
rJMSF018N07+ TCCGCAAGTCGTCGCTTTGTTGAGCGTGCTTACAAGTATCGACCTATCAAGGTAGTGGAG
                      ____________________________________________________________
consensus TCCGCAAGTCGTCGCTTTGTTGAGCGTGCTTACAAGTATCGACCTATCAAGGTAGTGGAG
 
. : . : . : . : . : . :
rJMSF022K01+ TTTGAGGTCCCTCGGCAACAGTGTATAGTCTACTTGGACCTAAAGCGTGAAGAGTGTGCT
rJMSF018N07+ TTTGAGGTCCCTCGGCAACAGTGTATAGTCTACTTGGACCTAAAGCGTGAAGAGTGTGCT
                      ____________________________________________________________
consensus TTTGAGGTCCCTCGGCAACAGTGTATAGTCTACTTGGACCTAAAGCGTGAAGAGTGTGCT
 
. : . : . : . : . : . :
rJMSF022K01+ AATTTGTTCCCATCTGGCCGAGTATATTCTCAAGCATTTCACCTGGGAGGACAAGGTTTT
rJMSF018N07+ AATTTGTTCCCATCTGGCCGAGTATATTCTCAAGCATTTCACCTGGGAGGACAAGGTTTT
                      ____________________________________________________________
consensus AATTTGTTCCCATCTGGCCGAGTATATTCTCAAGCATTTCACCTGGGAGGACAAGGTTTT
 
. : . : . : . : . : . :
rJMSF022K01+ TTCCTATCGGCACATTGTAACATGGATCAACAAAGCGCTTTCCACTGCTTTGGTCTATTT
rJMSF018N07+ TTCCTATCGGCACATTGTAACATGGATCAACAAAGCGCTTTCCACTGCTTTGGTCTATTT
                      ____________________________________________________________
consensus TTCCTATCGGCACATTGTAACATGGATCAACAAAGCGCTTTCCACTGCTTTGGTCTATTT
 
. : . : . : . : . : . :
rJMSF022K01+ CTGGGGATGCAGGAAAAGGGTTCTGTGTCATTCGCTGTCGACTATGAGTTTGCAGCTAGA
rJMSF018N07+ CTGGGGATGCAGGAAAAGGGTTCTGTGTCATTCGCTGTCGACTATGAGTTTGCAGCTAGA
                      ____________________________________________________________
consensus CTGGGGATGCAGGAAAAGGGTTCTGTGTCATTCGCTGTCGACTATGAGTTTGCAGCTAGA
 
. : . : . : . : . : . :
rJMSF022K01+ TCAAAGCCAACAGAGGAGTATATCAGCAAATACAAGGGTAACTACACCTTTACTGGTGGA
rJMSF018N07+ TCAAAGCCAACAGAGGAGTATATCAGCAAATACAAGGGTAACTACACCTTTACTGGTGGA
                      ____________________________________________________________
consensus TCAAAGCCAACAGAGGAGTATATCAGCAAATACAAGGGTAACTACACCTTTACTGGTGGA
 
. : . : . : . : . : . :
rJMSF022K01+ AAGGCGGTTGGCTATCGAAACTTGTTTGGTGTACAATGGACTTCTTTCATGGCAGATGAC
rJMSF018N07+ AAGGCGGTTGGCTATCGAAACTTGTTTGGTGTACAATGGACTTCTTTCATGGCAGATGAC
                      ____________________________________________________________
consensus AAGGCGGTTGGCTATCGAAACTTGTTTGGTGTACAATGGACTTCTTTCATGGCAGATGAC
 
. : . : . : . : . : . :
rJMSF022K01+ AGTCCTTACTTCATCAATGGCATACTCCATCTTAGGGCTGAGCTTACCATCAGGCACTAA
rJMSF018N07+ AGTCCTTACTTCATCAATGGCATACTCCATCTTAGGGCTGAGCTTACCATCAGGCACTAA
                      ____________________________________________________________
consensus AGTCCTTACTTCATCAATGGCATACTCCATCTTAGGGCTGAGCTTACCATCAGGCACTAA
 
. : . : . : . : . : . :
rJMSF022K01+ CTTCTTTCCACGATTTCCAACAAATTGTTATTTTCATTTTGGTTAGTTCCAGCCTTGTTT
rJMSF018N07+ CTTCTTTCCACGATTTCCAACAAATTGTTATTTTCATTTTGGTTAGTTCCAGCCTTGTTT
                      ____________________________________________________________
consensus CTTCTTTCCACGATTTCCAACAAATTGTTATTTTCATTTTGGTTAGTTCCAGCCTTGTTT
 
. : . : . : . : . : . :
rJMSF022K01+ CCCCAGCTCAAAAGAAGTAAGGAAAAGCTAAGGGAAATTTAAGGTGATGGCAGTCTAACA
rJMSF018N07+ CCCCAGCTCAAAAGAAGTAAGGAAAAGCTAAGGGAAATTTAAGGTGATGGCAGTCTAACA
                      ____________________________________________________________
consensus CCCCAGCTCAAAAGAAGTAAGGAAAAGCTAAGGGAAATTTAAGGTGATGGCAGTCTAACA
 
. : . : . : . : . : . :
rJMSF022K01+ GCTATAGTTTAGATCTTCAAAAAATGTGTATACATCCAAAT-AATTGGAATGATGAAAAT
rJMSF018N07+ GCTATAGTTTAGATCTTCAAAAAATGTGTATACATCCAAATGAATTGGAATGATGAAAAT
                      ____________________________________________________________
consensus GCTATAGTTTAGATCTTCAAAAAATGTGTATACATCCAAATGAATTGGAATGATGAAAAT
 
. : . : . : . : . : . :
rJMSF022K01+ CAAGTTTGTGGAGGCTAAAATTTTGGTCAGCTCAGTCTGTTGGAACTCTTCCACAAAAGT
rJMSF018N07+ CAAGTTTGTGGAGGCTAAAATTTTGGTCAGCTCAGTCTG-TGGAACTCTTCCACAAAAGT
                      ____________________________________________________________
consensus CAAGTTTGTGGAGGCTAAAATTTTGGTCAGCTCAGTCTGTTGGAACTCTTCCACAAAAGT