Previous Contig 012039:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF018L24Sequence312019090733012039 (2)gb:AY086403_15714527e-64Arabidopsis thaliana clone 249634 mRNA, complete sequence.
JMSF019L24Sequence130012039 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF018L24+ AATGGTAGACACG
                      ____________________________________________________________
consensus AATGGTAGACACG
 
. : . : . : . : . : . :
rJMSF018L24+ ATGGACCTGCAACACATGCAGTTACCTTTGTGTGGAATGGACCTGAGGGAGATAATGTCT
                      ____________________________________________________________
consensus ATGGACCTGCAACACATGCAGTTACCTTTGTGTGGAATGGACCTGAGGGAGATAATGTCT
 
. : . : . : . : . : . :
rJMSF018L24+ TCTTGGTTGGGGATTTTACGGGGAACTGGAAAGAACCGATTAGAGCAGTCCACAAAACTG
                      ____________________________________________________________
consensus TCTTGGTTGGGGATTTTACGGGGAACTGGAAAGAACCGATTAGAGCAGTCCACAAAACTG
 
. : . : . : . : . : . :
rJMSF018L24+ GCCCTAGATTTGAGGCTGAAGTTAGACTCTCACAGGGAAAGTACTACTATAAGTACATTA
                      ____________________________________________________________
consensus GCCCTAGATTTGAGGCTGAAGTTAGACTCTCACAGGGAAAGTACTACTATAAGTACATTA
 
. : . : . : . : . : . :
rJMSF018L24+ TAAATGGACAATGGAGACATTCGACAGATTCAGCGACTGAAAGGGATGAGAGAGGCAATA
                      ____________________________________________________________
consensus TAAATGGACAATGGAGACATTCGACAGATTCAGCGACTGAAAGGGATGAGAGAGGCAATA
 
. : . : . : . : . : . :
rJMSF018L24+ CTAATAATGTGATTGTGGTGGGTGATATTGCCAGTGTGAGGCCTTCTATGCAACAGCAGA
                      ____________________________________________________________
consensus CTAATAATGTGATTGTGGTGGGTGATATTGCCAGTGTGAGGCCTTCTATGCAACAGCAGA
 
. : . : . : . : . : . :
rJMSF018L24+ CGAAGGGTGCAAATATCATCAAGGTTATAGAGAGACCATTGACAGAAAACGAGCGCTTTA
                      ____________________________________________________________
consensus CGAAGGGTGCAAATATCATCAAGGTTATAGAGAGACCATTGACAGAAAACGAGCGCTTTA
 
. : . : . : . : . : . :
rJMSF018L24+ TGCTTGCAAAAGCTGCTCGGTGTATTGCATTCTCTATTTGCCCTATAAGGCTAGCACCAA
                      ____________________________________________________________
consensus TGCTTGCAAAAGCTGCTCGGTGTATTGCATTCTCTATTTGCCCTATAAGGCTAGCACCAA
 
. : . : . : . : . : . :
rJMSF019L24+ CCAGGTCAGTGA
rJMSF018L24+ AATAGCGGACTATACTACTACAGCATTCTCATGAAGGCTAGTGGTAACCCAGGTCAGTGA
                      ____________________________________________________________
consensus AATAGCGGACTATACTACTACAGCATTCTCATGAAGGCTAGTGGTAACCCAGGTCAGTGA
 
. : . : . : . : . : . :
rJMSF019L24+ TGTGGTGTGAGCTNGGCNTATTCNNAAGAANTNTGAAGGCTAGTANCCCNGGTCAGTAAN
rJMSF018L24+ TGTGGTGTGAGATTGGCGTATTCAGAAGAATTATGAAGGCTAGTAACCCAGGTCAGTAAT
                      ____________________________________________________________
consensus TGTGGTGTGAGCTTGGCGTATTCAGAAGAATTATGAAGGCTAGTAACCCAGGTCAGTAAT
 
. : . : . : . : . : . :
rJMSF019L24+ GTGTGCGAGATNGACATTCAGAGGAATCAGANGCGTGAGNTCAACTCAT
rJMSF018L24+ GTGTGCGAGATTGACATTCAGAGGAATCAGAAGCGTGAGATCAACTCATAGATCAGTTTA
                      ____________________________________________________________
consensus GTGTGCGAGATTGACATTCAGAGGAATCAGAAGCGTGAGATCAACTCATAGATCAGTTTA
 
. : . : . : . : . : . :
rJMSF018L24+ AGATTTTGACGTTACCAAATTGAATAAATCAGCTATATGGCCATATGGGTAAATCAGCTA
                      ____________________________________________________________
consensus AGATTTTGACGTTACCAAATTGAATAAATCAGCTATATGGCCATATGGGTAAATCAGCTA
 
. : . : . : . : . : . :
rJMSF018L24+ TATGGGTTGACCAAACAGGTCAGCAACTCATTTGGTAGATATTAAGTAAGGGATAGCTGT
                      ____________________________________________________________
consensus TATGGGTTGACCAAACAGGTCAGCAACTCATTTGGTAGATATTAAGTAAGGGATAGCTGT