Previous Contig 012037:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF018L15Sequence504012037 (2)gb:AF095753_17677851e-26Arabidopsis thaliana thioredoxin x mRNA, complete cds.769012037 (2)gb:AF095753_17677857e-40Arabidopsis thaliana thioredoxin x mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF018L15- GAAGCAGTGTTTGAGTCGCAGAGCAGTTGCTCAACAAATAACAATGGGA
rJMSF018L15+ GAAGCAGTGTTTGAGTCGCAGAGCAGTTGCTCAACAAATAACAATGGGA
                      ____________________________________________________________
consensus GAAGCAGTGTTTGAGTCGCAGAGCAGTTGCTCAACAAATAACAATGGGA
 
. : . : . : . : . : . :
JMSF018L15- GTCTTGGGCGCCTCAACTTCAAGCTGGCAGATTCCGGCGGGTTTGCCCCTCCCTCCGACT
rJMSF018L15+ GTCTTGGGCGCCTCAACTTCAAGCTGGCAGATTCCGGCGGGTTTGCCCCTCCCTCCGACT
                      ____________________________________________________________
consensus GTCTTGGGCGCCTCAACTTCAAGCTGGCAGATTCCGGCGGGTTTGCCCCTCCCTCCGACT
 
. : . : . : . : . : . :
JMSF018L15- CGTACGGTCTCCTTCTCACCACCACCCCGCAACTATAAAGCATCCTCATTTCTTTCTCCC
rJMSF018L15+ CGTACGGTCTCCTTCTCACCACCACCCCGCAACTATAAAGCATCCTCATTTCTTTCTCCC
                      ____________________________________________________________
consensus CGTACGGTCTCCTTCTCACCACCACCCCGCAACTATAAAGCATCCTCATTTCTTTCTCCC
 
. : . : . : . : . : . :
JMSF018L15- ATCTCCACCACAAATCTGAGGTGCGGGCGGTTAGGAAAGTGTTCCTCTATCTCCAAGTCC
rJMSF018L15+ ATCTCCACCACAAATCTGAGGTGCGGGCGGTTAGGAAAGTGTTCCTCTATCTCCAAGTCC
                      ____________________________________________________________
consensus ATCTCCACCACAAATCTGAGGTGCGGGCGGTTAGGAAAGTGTTCCTCTATCTCCAAGTCC
 
. : . : . : . : . : . :
JMSF018L15- AGGCTCAGGCTCAGGCTCAGGGTGAGCTGCGGAGCAGTAAGGGAGATAACGCAGGAGGAG
rJMSF018L15+ AGGCTCAGGCTCAGGCTCAGGGTGAGCTGCGGAGCAGTAAGGGAGATAACGCAGGAGGAG
                      ____________________________________________________________
consensus AGGCTCAGGCTCAGGCTCAGGGTGAGCTGCGGAGCAGTAAGGGAGATAACGCAGGAGGAG
 
. : . : . : . : . : . :
JMSF018L15- TTCTCCGACGTAGTTTTGAAGTCCGATCGACCCGTTTTAGTGGAGTTCGTCGCCACTTGG
rJMSF018L15+ TTCTCCGACGTAGTTTTGAAGTCCGATCGACCCGTTTTAGTGGAGTTCGTCGCCACTTGG
                      ____________________________________________________________
consensus TTCTCCGACGTAGTTTTGAAGTCCGATCGACCCGTTTTAGTGGAGTTCGTCGCCACTTGG
 
. : . : . : . : . : . :
JMSF018L15- TGCGGCCCCTGCCGCTTGATTGCTCCTGCTATAGAATCCATCGCTCAGGAACAAGAGTAT
rJMSF018L15+ TGCGGCCCCTGCCGCTTGATTGCTCCTGCTATAGAATCCATCGCTCAGGAACAAGAGTAT
                      ____________________________________________________________
consensus TGCGGCCCCTGCCGCTTGATTGCTCCTGCTATAGAATCCATCGCTCAGGAACAAGAGTAT
 
. : . : . : . : . : . :
JMSF018L15- AGGGAAAAGATAACAGTGGTTAAGATTGATCATGATTCAAATCCTCAGCTGATCGAAGAG
rJMSF018L15+ AGGGAAAAGATAACAGTGGTTAAGATTGATCATGATTCAAATCCTCAGCTGATCGAAGAG
                      ____________________________________________________________
consensus AGGGAAAAGATAACAGTGGTTAAGATTGATCATGATTCAAATCCTCAGCTGATCGAAGAG
 
. : . : . : . : . : . :
JMSF018L15- TACAAAGTTTACGGATTGCCAACTTTGATTCTCTT
rJMSF018L15+ TACAAAGTTTACGGATTGCCAACTTTGATTCTCTTCAAAGATGGAAAGGTAGTAGAAGAG
                      ____________________________________________________________
consensus TACAAAGTTTACGGATTGCCAACTTTGATTCTCTTCAAAGATGGAAAGGTAGTAGAAGAG
 
. : . : . : . : . : . :
rJMSF018L15+ AGCAGAAGGGAAGGCGCAATAACAAAAGTTAAGCTCAAGAAGCATCTTGACGGTCTTCTG
                      ____________________________________________________________
consensus AGCAGAAGGGAAGGCGCAATAACAAAAGTTAAGCTCAAGAAGCATCTTGACGGTCTTCTG
 
. : . : . : . : . : . :
rJMSF018L15+ GAGAGTATCTGTGCTGTGTAATCTTCAGCTACCAGATTTTGCTTTTTAGCTATTTCATTT
                      ____________________________________________________________
consensus GAGAGTATCTGTGCTGTGTAATCTTCAGCTACCAGATTTTGCTTTTTAGCTATTTCATTT
 
. : . : . : . : . : . :
rJMSF018L15+ CATTATATCATACCACTGAAAATGTAATTTGGAAATCATGTTTTTGTGCCCATATTAATT
                      ____________________________________________________________
consensus CATTATATCATACCACTGAAAATGTAATTTGGAAATCATGTTTTTGTGCCCATATTAATT
 
. : . : . : . : . : . :
rJMSF018L15+ TCTGATAAAGCCAAGCCTGTAATTTATGTTCTCGTTTCATTAAGCCATGCCCAGTGCATA
                      ____________________________________________________________
consensus TCTGATAAAGCCAAGCCTGTAATTTATGTTCTCGTTTCATTAAGCCATGCCCAGTGCATA