Previous Contig 012035:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF005A22Sequence280005293 (10)335012035 (4)
JMSF018L01Sequence485003593 (14)gb:AF316412_17855361e-23Helianthus annuus resistance gene analog NBS7 (NBS7) gene, partial cds.735012035 (4)gb:AP000492_18202812e-26Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0705D01
JMSF032I24Sequence688003593 (14)gb:AF316412_17855367e-41Helianthus annuus resistance gene analog NBS7 (NBS7) gene, partial cds.709012035 (4)gb:AP000492_18202812e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0705D01
JMSF035A03Sequence261003593 (14)719012035 (4)gb:AP000492_18202816e-25Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0705D01

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF018L01+ GCTACATACTCTTGC
                      ____________________________________________________________
consensus GCTACATACTCTTGC
 
. : . : . : . : . : . :
rJMSF032I24+ TTGCCAACTAATATATGCATCCTTCAAAGATGGGAATATTGGAGTGTTTGATGCACAT
rJMSF035A03+ TTGCCAACTAATATATGCATCCTTCAAAGATGGGAATATTGGAGTGTTTGATGCACAT
rJMSF018L01+ AATTGCCAACTAATATATGCATCCTTCAAAGATGGGAATATTGGAGTGTTTGATGCACAT
                      ____________________________________________________________
consensus AATTGCCAACTAATATATGCATCCTTCAAAGATGGGAATATTGGAGTGTTTGATGCACAT
 
. : . : . : . : . : . :
rJMSF032I24+ AGGTTAAGACCGAGATGTTGTATTGCTCCATCTGCTTATTTATCCCAGGCTGTATTGAAT
rJMSF035A03+ AGGTTAAGACCGAGATGTTGTATTGCTCCATCTGCTTATTTATCCCAGGCTGTATTGAAT
rJMSF018L01+ AGGTTAAGACCGAGATGTTGTATTGCTCCATCTGCTTATTTATCCCAGGCTGTATTGAAT
                      ____________________________________________________________
consensus AGGTTAAGACCGAGATGTTGTATTGCTCCATCTGCTTATTTATCCCAGGCTGTATTGAAT
 
. : . : . : . : . : . :
rJMSF032I24+ AGAAATGAGGGTGTGTATGCAGTTGTGATTGTAGCGCATCCACAAGAGCCCAACCAACTT
rJMSF035A03+ AGAAATGAGGGTGTGTATGCAGTTGTGATTGTAGCGCATCCACAAGAGCCCAACCAACTT
rJMSF018L01+ AGAAATGAGGGTGTGTATGCAGTTGTGATTGTAGCGCATCCACAAGAGCCCAACCAACTT
                      ____________________________________________________________
consensus AGAAATGAGGGTGTGTATGCAGTTGTGATTGTAGCGCATCCACAAGAGCCCAACCAACTT
 
. : . : . : . : . : . :
rJMSF032I24+ GCATTTGGATTGACAGATGGGTCTATTAAAGTTATTGAACCATTGGAATCCGGAGGGGAG
rJMSF035A03+ GCATTTGGATTGACAGATGGGTCTATTAAAGTTATTGAACCATTGGAATCCGGAGGGGAG
rJMSF018L01+ GCATTTGGATTGACAGATGGGTCTATTAAAGTTATTGAACCATTGGAATCCGGAGGGGAG
                      ____________________________________________________________
consensus GCATTTGGATTGACAGATGGGTCTATTAAAGTTATTGAACCATTGGAATCCGGAGGGGAG
 
. : . : . : . : . : . :
rJMSF032I24+ TGGGGAATATCTAGGAAAGAAGGTGAAGATGAGGAGATGGGTGATGAAGAAGGCCACCAA
rJMSF035A03+ TGGGGAATATCTAGGAAAGAAGGTGAAGATGAGGAGATGGGTGATGAAGAAGGCCACCAA
rJMSF018L01+ TGGGGAATATCTAGGAAAGAAGGTGAAGATGAGGAGATGGGTGATGAAGAAGGCCACCAA
                      ____________________________________________________________
consensus TGGGGAATATCTAGGAAAGAAGGTGAAGATGAGGAGATGGGTGATGAAGAAGGCCACCAA
 
. : . : . : . : . : . :
rJMSF032I24+ TTGGAACAAAGAAAGAAGGCCCGACTTGATAAGGGCAAGGCTCCGCTTATTTAAAGGGTG
rJMSF035A03+ TTGGAACAAAGAAAGAAGGCCCGACTTGATAAGGGCAAGGCTCCGCTTATTTAAAGGGTG
rJMSF005A22+ TATTTAAAGGGCG
rJMSF018L01+ TTGGAACAAAGAAAGAAGGCCCGACTTGATAAGGGCAAGGCTCCGCTTATTTAAAGGGTG
                      ____________________________________________________________
consensus TTGGAACAAAGAAAGAAGGCCCGACTTGATAAGGGCAAGGCTCCGCTTATTTAAAGGGTG
 
. : . : . : . : . : . :
rJMSF032I24+ TTTTTGGCAATGTTGCTCAGTTGTTTTACAGGGCATTCAGAGACATGGGTAATGCTGGTG
rJMSF035A03+ TTTTTGGCAATGTTGCTCAGTTGTTTTACAGGGCATTCAGAGACATGGGTAATGCTGGTG
rJMSF005A22+ TTTTTGGCAATGTTGCTCAGTTGTTTTACAGGGCATTCAGAGACATGGGTANTGCTGGTG
rJMSF018L01+ TTTTTGGCAATGTTGCTCAGTTGTTTTACAGGGCATTCAGAGACATGGGTAATGCTGGTG
                      ____________________________________________________________
consensus TTTTTGGCAATGTTGCTCAGTTGTTTTACAGGGCATTCAGAGACATGGGTAATGCTGGTG
 
. : . : . : . : . : . :
rJMSF032I24+ TCTTTTGAGGTGTGTTTGGAGTACATTGGCAGTATTTTTGCAATGGAATTTGCAGGGTGT
rJMSF035A03+ TCTTTTGAGGTGTGTTTGGAGTACATTGGCAGTATTTTTGCAATGGAATTTGCAGGGTGT
rJMSF005A22+ TCTTCTGAGGNGTGTCNGGAGNACATTGGCAGTATTTTTGCAATGNAATTTGCAGGGTGT
rJMSF018L01+ TCTTTTGAGGTGTGTTTGGAGTACATTGGCAGTATTTTTGCAATGGAATTTGCAGGGTGT
                      ____________________________________________________________
consensus TCTTTTGAGGTGTGTTTGGAGTACATTGGCAGTATTTTTGCAATGGAATTTGCAGGGTGT
 
. : . : . : . : . : . :
rJMSF032I24+ TTTGCTCTCAAGTGTGGTTGAAATTTGCTGTTGGTATAGGTGTGTGTTGATATCAGTGTT
rJMSF035A03+ TTTGCTCTCAAGTGTGGTTGAAATTTGCTGTTGGTATAGGTGTGTGTTGATATCAGTGTT
rJMSF005A22+ TTTGCTCTCAAGTGTGGTTGNAATTTGCTGTTNGTATAGGTGTGTGTTGATATCAGTGTT
rJMSF018L01+ TTTGCTCTCAAGTGTGGTTGAAATTTGCTGTTGGTATAGGTGTGTGTTGATATCAGTGTT
                      ____________________________________________________________
consensus TTTGCTCTCAAGTGTGGTTGAAATTTGCTGTTGGTATAGGTGTGTGTTGATATCAGTGTT
 
. : . : . : . : . : . :
rJMSF032I24+ TTTTCAAGTGTGTTGGCTGTGGACTTTGTAGCATGTGTGATATCTGGTCTTCCACCATTT
rJMSF035A03+ TTTTCAAGTGTGTTGGCTGTGGACTTTGTAGCATGTGTGATATCTGGTCTTCCACCATTT
rJMSF005A22+ TTTTCAAGTNNGTTGGCTGTGGACTNNCTAGCATGTGTGATATCTGGTCTTCCACCATTT
rJMSF018L01+ TTTTCAAGTGTGTTGGCTGTGGACTTTGTAGCATGTGTGATATCTGGTCTTCCACCATTT
                      ____________________________________________________________
consensus TTTTCAAGTGTGTTGGCTGTGGACTTTGTAGCATGTGTGATATCTGGTCTTCCACCATTT
 
. : . : . : . : . : . :
rJMSF032I24+ CTTTCGATTCAAAGGTTTTTGTTGTGCTTGGTTATGTAATTTTGTTGTTATTAATGTTGC
rJMSF035A03+ CTTTCGATTCAAAGGTTTTTGGTGTGCTTGGTTATGTAATTTTGTTGTTATTAATGTTGC
rJMSF005A22+ CTTTCGATTCAAAGGTTTTTGGTGTGCTTGGCTANGTAACTTTGTTGTTATTAATGTTNC
rJMSF018L01+ CTTTCGATTCAAAGGTTTTTGGTGTGCTTGGTTATGTAATTTTGTTGTTATTAATGTTGC
                      ____________________________________________________________
consensus CTTTCGATTCAAAGGTTTTTGGTGTGCTTGGTTATGTAATTTTGTTGTTATTAATGTTGC
 
. : . : . : . : . : . :
rJMSF032I24+ CATGTGGACCAGTAGGTTATGTAATCCTTCGACTTTAG-CCATGGCATTGTT
rJMSF035A03+ CATGTGGACCAGTAGGTTATGTAATCCTTCGACTTTAG-CCATGGCATTGTT
rJMSF005A22+ CATGTGGA-CACTAGGTTATGTA
rJMSF018L01+ CATGTGGACCAGTAGGTTATGTAATCCTTCGACTTTAGCCCATGGCATTGTTTGTGACGA
                      ____________________________________________________________
consensus CATGTGGACCAGTAGGTTATGTAATCCTTCGACTTTAG-CCATGGCATTGTTTGTGACGA