Previous Contig 012029:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF018J01Sequence501012029 (2)pir|T04804|T048046e-36hypothetical protein F10M23.150 - Arabidopsis thaliana>gb:ATCHRIV65_1546562 Arab727012029 (2)pir|T04804|T048042e-37hypothetical protein F10M23.150 - Arabidopsis thaliana>gb:ATCHRIV65_1546562 Arab

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF018J01- GGCGAACCCTCTCGTCTACCCATCAAGTCGGCTACAGCTTGAGGTCAAGCTGTT
                      ____________________________________________________________
consensus GGCGAACCCTCTCGTCTACCCATCAAGTCGGCTACAGCTTGAGGTCAAGCTGTT
 
. : . : . : . : . : . :
JMSF018J01- TGATAAAATTTCTGTTATGGTTCCAGCATGAAACAAGCAAAAAATCTCTTCTTTTTTTGT
                      ____________________________________________________________
consensus TGATAAAATTTCTGTTATGGTTCCAGCATGAAACAAGCAAAAAATCTCTTCTTTTTTTGT
 
. : . : . : . : . : . :
JMSF018J01- TTTTGTCTTTGATTATTATCACCATGTGGAGAGGGATTTGATTACGGTTTCTTCTTTACT
rJMSF018J01+ CTTTACT
                      ____________________________________________________________
consensus TTTTGTCTTTGATTATTATCACCATGTGGAGAGGGATTTGATTACGGTTTCTTCTTTACT
 
. : . : . : . : . : . :
JMSF018J01- ACAGTTAAAGGAAAATACTTAAGACGAGGGAAGAAGAAAATGCTGCCTCACAAGATGAAG
rJMSF018J01+ ACAGTTAAAGGAAAATACTTAAGACGAGGGAAGAAGAAAATGCTGCCTCACAAGATGAAG
                      ____________________________________________________________
consensus ACAGTTAAAGGAAAATACTTAAGACGAGGGAAGAAGAAAATGCTGCCTCACAAGATGAAG
 
. : . : . : . : . : . :
JMSF018J01- AGCTTCGTTGCGGAAAACCCAAAGAAATTAGGGAACTTAATTAACCTAGTTAATCTCCCT
rJMSF018J01+ AGCTTCGTTGCGGAAAACCCAAAGAAATTAGGGAACTTAATTAACCTAGTTAATCTCCCT
                      ____________________________________________________________
consensus AGCTTCGTTGCGGAAAACCCAAAGAAATTAGGGAACTTAATTAACCTAGTTAATCTCCCT
 
. : . : . : . : . : . :
JMSF018J01- TCAGCACTAAGAGACTTCATGGGTCAGTCCCAGACGTCGCGTTTGGGTTGTTTCAAGCGT
rJMSF018J01+ TCAGCACTAAGAGACTTCATGGGTCAGTCCCAGACGTCGCGTTTGGGTTGTTTCAAGCGT
                      ____________________________________________________________
consensus TCAGCACTAAGAGACTTCATGGGTCAGTCCCAGACGTCGCGTTTGGGTTGTTTCAAGCGT
 
. : . : . : . : . : . :
JMSF018J01- ATTTGGTCATACATCAAGGAGAACAATCTCCAGGATCCAAATAACAAGAACTTAGTCAAC
rJMSF018J01+ ATTTGGTCATACATCAAGGAGAACAATCTCCAGGATCCAAATAACAAGAACTTAGTCAAC
                      ____________________________________________________________
consensus ATTTGGTCATACATCAAGGAGAACAATCTCCAGGATCCAAATAACAAGAACTTAGTCAAC
 
. : . : . : . : . : . :
JMSF018J01- TGCGATGAAAAACTGAAGAGCATTCTGTTGGGTAAATCCCAGGTTGATCTGGCTGAACTT
rJMSF018J01+ TGCGATGAAAAACTGAAGAGCATTCTGTTGGGTAAATCCCAGGTTGATCTGGCTGAACTT
                      ____________________________________________________________
consensus TGCGATGAAAAACTGAAGAGCATTCTGTTGGGTAAATCCCAGGTTGATCTGGCTGAACTT
 
. : . : . : . : . : . :
JMSF018J01- CCTGCACTCCTCANGTTGCATTTTCCT
rJMSF018J01+ CCTGCACTCCTCAAGTTGCATTTTCCTAAACCCAACTCAAAATGATTGCTATTATTCAAC
                      ____________________________________________________________
consensus CCTGCACTCCTCAAGTTGCATTTTCCTAAACCCAACTCAAAATGATTGCTATTATTCAAC
 
. : . : . : . : . : . :
rJMSF018J01+ TATTTTGAGCCTGAGAGGTGCAAACTACTGATCTTTATGGGAAGAGAAGATTGATTCATT
                      ____________________________________________________________
consensus TATTTTGAGCCTGAGAGGTGCAAACTACTGATCTTTATGGGAAGAGAAGATTGATTCATT
 
. : . : . : . : . : . :
rJMSF018J01+ TTTCAATTCATTACCAGTTGGAAGAGGTTGAGCTCTCTCTCTATCCCTATCAATTGTTGG
                      ____________________________________________________________
consensus TTTCAATTCATTACCAGTTGGAAGAGGTTGAGCTCTCTCTCTATCCCTATCAATTGTTGG
 
. : . : . : . : . : . :
rJMSF018J01+ CAACACAGAATGCTGGTTTTGGGCACGCTTTTAGCAGCCTCCATAGCCTAGGGCAATGAT
                      ____________________________________________________________
consensus CAACACAGAATGCTGGTTTTGGGCACGCTTTTAGCAGCCTCCATAGCCTAGGGCAATGAT
 
. : . : . : . : . : . :
rJMSF018J01+ CAAAGCTGTGTTCTTTGTTGTGTGACCATTGCTTTTATTGTAAGATAACTGATATTGTTT
                      ____________________________________________________________
consensus CAAAGCTGTGTTCTTTGTTGTGTGACCATTGCTTTTATTGTAAGATAACTGATATTGTTT
 
. : . : . : . : . : . :
rJMSF018J01+ TCTGATGAACATACATATCATTGAGCTTATATTTACGTTTTGATATCAGAAGTCAAAAAA
                      ____________________________________________________________
consensus TCTGATGAACATACATATCATTGAGCTTATATTTACGTTTTGATATCAGAAGTCAAAAAA
 
. : . : . : . : . : . :
rJMSF018J01+ TGCAGGCTGGATTATACAGAACATGTTCTTTGTTGTGTGACAATTGCTTTTANTGAANGA
                      ____________________________________________________________
consensus TGCAGGCTGGATTATACAGAACATGTTCTTTGTTGTGTGACAATTGCTTTTANTGAANGA