Previous Contig 012019:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF018H06Sequence598012019 (2)gb:ATT6G21_15563161e-31Arabidopsis thaliana DNA chromosome 5, BAC clone T6G21 (ESSA project).>gb:BT0159708012019 (2)gb:ATT6G21_15563163e-44Arabidopsis thaliana DNA chromosome 5, BAC clone T6G21 (ESSA project).>gb:BT0159

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF018H06- GGTGTTGAAGTGCATAGGC
                      ____________________________________________________________
consensus GGTGTTGAAGTGCATAGGC
 
. : . : . : . : . : . :
JMSF018H06- TTGTGTAGAGGATGAGACGGGGAGGGGGGCATTACGGCGGCGCCGGAGATTCCACCGCCA
                      ____________________________________________________________
consensus TTGTGTAGAGGATGAGACGGGGAGGGGGGCATTACGGCGGCGCCGGAGATTCCACCGCCA
 
. : . : . : . : . : . :
JMSF018H06- ATAACGCATATTCCCAGATTCAACATCACCCCCAACACGCCAGGTCTGAAGAACATCAGC
                      ____________________________________________________________
consensus ATAACGCATATTCCCAGATTCAACATCACCCCCAACACGCCAGGTCTGAAGAACATCAGC
 
. : . : . : . : . : . :
JMSF018H06- AGCAACAGCAGCAATGGAGATGGGAACGAGAGAGCCCCAAACTGCCCACCAACGCTATGT
                      ____________________________________________________________
consensus AGCAACAGCAGCAATGGAGATGGGAACGAGAGAGCCCCAAACTGCCCACCAACGCTATGT
 
. : . : . : . : . : . :
JMSF018H06- CTCCCCACATGTTCTCTGAAGGTCAGGGAGCCGAAGCATCAAGATCCTATTATCAGGGCC
rJMSF018H06+ TGAAGGTCAGGGAGCCGAAGCATCAAGATCCTATTATCAGGGCC
                      ____________________________________________________________
consensus CTCCCCACATGTTCTCTGAAGGTCAGGGAGCCGAAGCATCAAGATCCTATTATCAGGGCC
 
. : . : . : . : . : . :
JMSF018H06- AGAGGACAGATCCAAGGATGCCATTAGAGAACCAAGGTGGCAAAGATCACGGATCTCAGC
rJMSF018H06+ AGAGGACAGATCCAAGGATGCCATTAGAGAACCAAGGTGGCAAAGATCACGGATCTCAGC
                      ____________________________________________________________
consensus AGAGGACAGATCCAAGGATGCCATTAGAGAACCAAGGTGGCAAAGATCACGGATCTCAGC
 
. : . : . : . : . : . :
JMSF018H06- CAATAGAAGAAGATATGGATATTGGTTATGAAGATAATCCCATGCCACAGTCTCTGGAGG
rJMSF018H06+ CAATAGAAGAAGATATGGATATTGGTTATGAAGATAATCCCATGCCACAGTCTCTGGAGG
                      ____________________________________________________________
consensus CAATAGAAGAAGATATGGATATTGGTTATGAAGATAATCCCATGCCACAGTCTCTGGAGG
 
. : . : . : . : . : . :
JMSF018H06- GCCTTGAACAGAAGTTCCTCGATGACATCATGAAGCTGAGCAAGGAACAAAATGACGCAG
rJMSF018H06+ GCCTTGAACAGAAGTTCCTCGATGACATCATGAAGCTGAGCAAGGAACAAAATGACGCAG
                      ____________________________________________________________
consensus GCCTTGAACAGAAGTTCCTCGATGACATCATGAAGCTGAGCAAGGAACAAAATGACGCAG
 
. : . : . : . : . : . :
JMSF018H06- AGGATGCCGAAAATGCTAGGCATAGGGAGCGAATAAATGCAATCAATGCTCAGTACCAAG
rJMSF018H06+ AGGATGCCGAAAATGCTAGGCATAGGGAGCGAATAAATGCAATCAATGCTCAGTACCAAG
                      ____________________________________________________________
consensus AGGATGCCGAAAATGCTAGGCATAGGGAGCGAATAAATGCAATCAATGCTCAGTACCAAG
 
. : . : . : . : . : . :
JMSF018H06- AGCAGCTAGTAGCCCTAAGAGCCCGGCATGCGAGTCGCAGAGAGGATTTTCTTCGCCGGG
rJMSF018H06+ AGCAGCTAGTAGCCCTAAGAGCCCGGCATGCGAGTCGCAGAGAGGATTTTCTTCGCCGGG
                      ____________________________________________________________
consensus AGCAGCTAGTAGCCCTAAGAGCCCGGCATGCGAGTCGCAGAGAGGATTTTCTTCGCCGGG
 
. : . : . : . : . : . :
JMSF018H06- AATCCCATGCGAGGCGTCAGCAGTACCAACAGGTTGCAT
rJMSF018H06+ AATCCCATGCGAGGCGTCAGCAGTACCAACAGGTTGCATTGGATAACCATCCAAACACTA
                      ____________________________________________________________
consensus AATCCCATGCGAGGCGTCAGCAGTACCAACAGGTTGCATTGGATAACCATCCAAACACTA
 
. : . : . : . : . : . :
rJMSF018H06+ ATGCAGGAGGCCCTATTGATCCTCGTGGATACGCTGCACCAACTCCCGTGCCTGGGGAGC
                      ____________________________________________________________
consensus ATGCAGGAGGCCCTATTGATCCTCGTGGATACGCTGCACCAACTCCCGTGCCTGGGGAGC
 
. : . : . : . : . : . :
rJMSF018H06+ GACAACGAGCCTATAATGCCAATAATTATGATTCGTACAGAGACCGAAACCGGTTTGTTG
                      ____________________________________________________________
consensus GACAACGAGCCTATAATGCCAATAATTATGATTCGTACAGAGACCGAAACCGGTTTGTTG
 
. : . : . : . : . : . :
rJMSF018H06+ GAAGCGGAAGAGATCAAGGGTATGAACCTAGAGCTCAGTACCCCGGGGGCCGTGGTTACG
                      ____________________________________________________________
consensus GAAGCGGAAGAGATCAAGGGTATGAACCTAGAGCTCAGTACCCCGGGGGCCGTGGTTACG
 
. : . : . : . : . : . :
rJMSF018H06+ ACCCCGGGTCGGGGTCGCGCTACTACTGATGTATCTGTGTTGGCAGTGCCTGAAATTTTG
                      ____________________________________________________________
consensus ACCCCGGGTCGGGGTCGCGCTACTACTGATGTATCTGTGTTGGCAGTGCCTGAAATTTTG
 
. : . : . : . : . : . :
rJMSF018H06+ TCCATTATGCCCCTTAAAAAAATGCTTAATTATAGTGAATCATACTCCAGTCATGTATTT
                      ____________________________________________________________
consensus TCCATTATGCCCCTTAAAAAAATGCTTAATTATAGTGAATCATACTCCAGTCATGTATTT