Previous Contig 012016:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF018G21Sequence450012016 (6)gb:OSA270955_16924272e-48Oryza sativa mRNA for putative phospholipid hydroperoxide glutathione peroxidase753012016 (6)sp|Q9LYB4|GPX3_ARATH4e-65Probable glutathione peroxidase At3g63080 (EC 1.11.1.9).>pir|T48097|T48097 gluta
JMSF029G22Sequence615012016 (6)gb:OSA270955_16924272e-61Oryza sativa mRNA for putative phospholipid hydroperoxide glutathione peroxidase739012016 (6)sp|Q9LYB4|GPX3_ARATH4e-65Probable glutathione peroxidase At3g63080 (EC 1.11.1.9).>pir|T48097|T48097 gluta
JMSF038A19Sequence659012016 (6)gb:OSA270955_16924272e-63Oryza sativa mRNA for putative phospholipid hydroperoxide glutathione peroxidase801012016 (6)sp|Q9LYB4|GPX3_ARATH4e-65Probable glutathione peroxidase At3g63080 (EC 1.11.1.9).>pir|T48097|T48097 gluta

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF029G22- GAGTTGAC
                      ____________________________________________________________
consensus GAGTTGAC
 
. : . : . : . : . : . :
JMSF018G21- AGGAGTAAAGACAGACCCA-
JMSF029G22- AATTAAGGAGATAGGTGGCGACGACACAGTTTTAGCCATAAGGAGTAAAGACAGACCCA-
JMSF038A19- AGGAGTAAAGACAGACCCA-
rJMSF038A19+ AGGAGTAAAGACAGACCCAC
                      ____________________________________________________________
consensus AATTAAGGAGATAGGTGGCGACGACACAGTTTTAGCCATAAGGAGTAAAGACAGACCCA-
 
. : . : . : . : . : . :
JMSF018G21- CCCCCACGCATACGGTTTTGCTCCGCCTCTTATCGGCCGCGCAGCCGCCGGGAAAACATG
JMSF029G22- CCCCCACGCATACGGTTTTGCTCCGCCTCTTATCGGCCGCGCAGCCGCCGGGAAAACATG
JMSF038A19- CCCCCACGCATACGGTTTTGCTCCGCCTCTTATCGGCCGCGCAGCCGCCGGGAAAACATG
rJMSF038A19+ CCCCCACGCATACGGTTTTGCTCCGCCTCTTATCGGCCGCGCAGCCGCCGGGAAAACATG
rJMSF029G22+ TCGGCCGCGCAGCCGCCGGGAAAACATG
rJMSF018G21+ TCTTATCGGCCGCGCAGCCGCCGGGAAAACATG
                      ____________________________________________________________
consensus CCCCCACGCATACGGTTTTGCTCCGCCTCTTATCGGCCGCGCAGCCGCCGGGAAAACATG
 
. : . : . : . : . : . :
JMSF018G21- GGCGCTTCCCTATCCGCCGGCGATTCCCCTCCACACAAGTCGATTCACGAATTCACTGTC
JMSF029G22- GGCGCTTCCCTATCCGCCGGCGATTCCCCTCCACACAAGTCGATTCACGAATTCACTGTC
JMSF038A19- GGCGCTTCCCTATCCGCCGGCGATTCCCCTCCACACAAGTCGATTCACGAATTCACTGTC
rJMSF038A19+ GGCGCTTCCCTATCCGCCGGCGATTCCCCTCCACACAAGTCGATTCACGAATTCACTGTC
rJMSF029G22+ GGCGCTTCCCTATCCGCCGGCGATTCCCCTCCACACAAGTCGATTCACGAATTCACTGTC
rJMSF018G21+ GGCGCTTCCCTATCCGCCGGCGATTCCCCTCCACACAAGTCGATTCACGAATTCACTGTC
                      ____________________________________________________________
consensus GGCGCTTCCCTATCCGCCGGCGATTCCCCTCCACACAAGTCGATTCACGAATTCACTGTC
 
. : . : . : . : . : . :
JMSF018G21- AAGGATTGCAAACGTAATGATGTGGACCTCAGCATTTACAAGGGCAAAGTGCTTCTCGTC
JMSF029G22- AAGGATTGCAAACGTAATGATGTGGACCTCAGCATTTACAAGGGCAAAGTGCTTCTCGTC
JMSF038A19- AAGGATTGCAAACGTAATGATGTGGACCTCAGCATTTACAAGGGCAAAGTGCTTCTCGTC
rJMSF038A19+ AAGGATTGCAAACGTAATGATGTGGACCTCAGCATTTACAAGGGCAAAGTGCTTCTCGTC
rJMSF029G22+ AAGGATTGCAAACGTAATGATGTGGACCTCAGCATTTACAAGGGCAAAGTGCTTCTCGTC
rJMSF018G21+ AAGGATTGCAAACGTAATGATGTGGACCTCAGCATTTACAAGGGCAAAGTGCTTCTCGTC
                      ____________________________________________________________
consensus AAGGATTGCAAACGTAATGATGTGGACCTCAGCATTTACAAGGGCAAAGTGCTTCTCGTC
 
. : . : . : . : . : . :
JMSF018G21- GTCAATGTTGCTTCCAGATGTGGGCTCACAAACGCTAACTACACGCAGCTGACTGAGTTG
JMSF029G22- GTCAATGTTGCTTCCAGATGTGGGCTCACAAACGCTAACTACACGCAGCTGACTGAGTTG
JMSF038A19- GTCAATGTTGCTTCCAGATGTGGGCTCACAAACGCTAACTACACGCAGCTGACTGAGTTG
rJMSF038A19+ GTCAATGTTGCTTCCAGATGTGGGCTCACAAACGCTAACTACACGCAGCTGACTGAGTTG
rJMSF029G22+ GTCAATGTTGCTTCCAGATGTGGGCTCACAAACGCTAACTACACGCAGCTGACTGAGTTG
rJMSF018G21+ GTCAATGTTGCTTCCAGATGTGGGCTCACAAACGCTAACTACACGCAGCTGACTGAGTTG
                      ____________________________________________________________
consensus GTCAATGTTGCTTCCAGATGTGGGCTCACAAACGCTAACTACACGCAGCTGACTGAGTTG
 
. : . : . : . : . : . :
JMSF018G21- TACAGCAAATATAAGGATAAAGGATTTGAAATCTTAGGTTTCCCCTGCAATCAATTCCTG
JMSF029G22- TACAGCAAATATAAGGATAAAGGATTTGAAATCTTAGGTTTCCCCTGCAATCAATTCCTG
JMSF038A19- TACAGCAAATATAAGGATAAAGGATTTGAAATCTTAGGTTTCCCCTGCAATCAATTCCTG
rJMSF038A19+ TACAGCAAATATAAGGATAAAGGATTTGAAATCTTAGGTTTCCCCTGCAATCAATTCCTG
rJMSF029G22+ TACAGCAAATATAAGGATAAAGGATTTGAAATCTTAGGTTTCCCCTGCAATCAATTCCTG
rJMSF018G21+ TACAGCAAATATAAGGATAAAGGATTTGAAATCTTAGGTTTCCCCTGCAATCAATTCCTG
                      ____________________________________________________________
consensus TACAGCAAATATAAGGATAAAGGATTTGAAATCTTAGGTTTCCCCTGCAATCAATTCCTG
 
. : . : . : . : . : . :
JMSF018G21- AAGCAAGAGCCAGGGACAAGTGAGGAAGCACAAGACTTTGCTTGCACTAGGTTCAAAGCT
JMSF029G22- AAGCAAGAGCCAGGGACAAGTGAGGAAGCACAAGACTTTGCTTGCACTAGGTTCAAAGCT
JMSF038A19- AAGCAAGAGCCAGGGACAAGTGAGGAAGCACAAGACTTTGCTTGCACTAGGTTCAAAGCT
rJMSF038A19+ AAGCAAGAGCCAGGGACAAGTGAGGAAGCACAAGACTTTGCTTGCACTAGGTTCAAAGCT
rJMSF029G22+ AAGCAAGAGCCAGGGACAAGTGAGGAAGCACAAGACTTTGCTTGCACTAGGTTCAAAGCT
rJMSF018G21+ AAGCAAGAGCCAGGGACAAGTGAGGAAGCACAAGACTTTGCTTGCACTAGGTTCAAAGCT
                      ____________________________________________________________
consensus AAGCAAGAGCCAGGGACAAGTGAGGAAGCACAAGACTTTGCTTGCACTAGGTTCAAAGCT
 
. : . : . : . : . : . :
JMSF018G21- GAATATCCCATCTTCCAAAAAGTGAAAGTTAACGGTCCAGATGCAGCACCAGTCTACAAG
JMSF029G22- GAATATCCCATCTTCCAAAAAGTGAAAGTTAACGGTCCAGATGCAGCACCAGTCTACAAG
JMSF038A19- GAATATCCCATCTTCCAAAAAGTGAAAGTTAACGGTCCAGATGCAGCACCAGTCTACAAG
rJMSF038A19+ GAATATCCCATCTTCCAAAAAGTGAAAGTTAACGGTCCAGATGCAGCACCAGTCTACAAG
rJMSF029G22+ GAATATCCCATCTTCCAAAAAGTGAAAGTTAACGGTCCAGATGCAGCACCAGTCTACAAG
rJMSF018G21+ GAATATCCCATCTTCCAAAAAGTGAAAGTTAACGGTCCAGATGCAGCACCAGTCTACAAG
                      ____________________________________________________________
consensus GAATATCCCATCTTCCAAAAAGTGAAAGTTAACGGTCCAGATGCAGCACCAGTCTACAAG
 
. : . : . : . : . : . :
JMSF018G21- TTCCTTAAA
JMSF029G22- TTCCTTAAATCAAGTAAAGGTGGCTTTTGTGGTTCCAGCATCAAGTGGAACTTCACCAAG
JMSF038A19- TTCCTTAAATCAAGTAAAGGTGGCTTTTGTGGTTCCAGCATCAAGTGGAACTTCACCAAG
rJMSF038A19+ TTCCTTAAATCAAGTAAAGGTGGCTTTTGTGGTTCCAGCATCAAGTGGAACTTCACCAAG
rJMSF029G22+ TTCCTTAAATCAAGTAAAGGTGGCTTTTGTGGTTCCAGCATCAAGTGGAACTTCACCAAG
rJMSF018G21+ TTCCTTAAATCAAGTAAAGGTGGCTTTTGTGGTTCCAGCATCAAGTGGAACTTCACCAAG
                      ____________________________________________________________
consensus TTCCTTAAATCAAGTAAAGGTGGCTTTTGTGGTTCCAGCATCAAGTGGAACTTCACCAAG
 
. : . : . : . : . : . :
JMSF029G22- TTCTTAGTTGACAAAGAAGGGATCGTTATTAAGCGTTTTGGCAGCAATACTCCACCATCT
JMSF038A19- TTCTTAGTTGACAAAGAAGGGATCGTTATTAAGCGTTTTGGCAGCAATACTCCACCATCT
rJMSF038A19+ TTCTTAGTTGACAAAGAAGGGATCGTTATTAAGCGTTTTGGCAGCAATACTCCACCATCT
rJMSF029G22+ TTCTTAGTTGACAAAGAAGGGATCGTTATTAAGCGTTTTGGCAGCAATACTCCACCATCT
rJMSF018G21+ TTCTTAGTTGACAAAGAAGGGATCGTTATTAAGCGTTTTGGCAGCAATACTCCACCATCT
                      ____________________________________________________________
consensus TTCTTAGTTGACAAAGAAGGGATCGTTATTAAGCGTTTTGGCAGCAATACTCCACCATCT
 
. : . : . : . : . : . :
JMSF029G22- GCAATTGA
JMSF038A19- GCAATTGAGGAAGATATCCGAAAGGCATTANGAGAGGAGTGAGAGGCTTTACACAATCTT
rJMSF038A19+ GCAATTGAGGAAGATATCCGAAAGGCATTAGGAGAGGAGTGAGAGGCTTTACACAATCTT
rJMSF029G22+ GCAATTGAGGAAGATATCCGAAAGGCATTAGGAGAGGAGTGAGAGGCTTTACACAATCTT
rJMSF018G21+ GCAATTGAGGAAGATATCCGAAAGGCATTAGGAGAGGAGTGAGAGGCTTTACACAATCTT
                      ____________________________________________________________
consensus GCAATTGAGGAAGATATCCGAAAGGCATTAGGAGAGGAGTGAGAGGCTTTACACAATCTT
 
. : . : . : . : . : . :
JMSF038A19- TATGCTGAAAAGAACGGTCATACTTATACTAA
rJMSF038A19+ TATGCTGAAAAGAACGGTCATACTTATACTAAGAGTGAAGGGTCTAGCAGATGAGTTAAG
rJMSF029G22+ TATGCTGAAAAGAACGGTCATACTTATACTAAGAGTGAAGGGTCTAGCAGATGAGTTAAG
rJMSF018G21+ TATGCTGAAAAGAACGGTCATACTTATACTAAGAGTGAAGGGTCTAGCAGATGAGTTAAG
                      ____________________________________________________________
consensus TATGCTGAAAAGAACGGTCATACTTATACTAAGAGTGAAGGGTCTAGCAGATGAGTTAAG
 
. : . : . : . : . : . :
rJMSF038A19+ TTCTTCTAAATGTTTATATTCTATGCTTTGTTTTGGCACTTGAAGTGAATCTGTGATTAA
rJMSF029G22+ TTCTTCTAAATGTTTATATTCTATGCTTTGTTTTGGCACTTGAAGTGAATCTGTGATTAA
rJMSF018G21+ TTCTTCTAAATGTTTATATTCTATGCTTTGTTTTGGCACTTGAAGTGAATCTGTGATTAA
                      ____________________________________________________________
consensus TTCTTCTAAATGTTTATATTCTATGCTTTGTTTTGGCACTTGAAGTGAATCTGTGATTAA
 
. : . : . : . : . : . :
rJMSF038A19+ CCTATCTATTATTATCATATTCCACCATGTAATATACTAATTATGA
rJMSF029G22+ CCTATCTATTATTATCATATTCCACCATGTAATATACTAATTATGA
rJMSF018G21+ CCTATCTATTATTATCATATTCCACCATGTAATATACTAATTATGACCCATGTGTTATAT
                      ____________________________________________________________
consensus CCTATCTATTATTATCATATTCCACCATGTAATATACTAATTATGACCCATGTGTTATAT