Previous Contig 012012:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF018E19Sequence223007312 (3)729012012 (3)pir|T51094|T51094e-128acid phosphatase (EC 3.1.3.2) purple 1, precursor [similarity] - sweet potato>gb
JMSF027N16Sequence666007312 (3)pir|T51094|T510942e-86acid phosphatase (EC 3.1.3.2) purple 1, precursor [similarity] - sweet potato>gb723012012 (3)pir|T51094|T51094e-117acid phosphatase (EC 3.1.3.2) purple 1, precursor [similarity] - sweet potato>gb
JMSF039L24Sequence666007312 (3)pir|T51094|T510942e-51acid phosphatase (EC 3.1.3.2) purple 1, precursor [similarity] - sweet potato>gb792012012 (3)pir|T51094|T51094e-142acid phosphatase (EC 3.1.3.2) purple 1, precursor [similarity] - sweet potato>gb

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF039L24+ CTGCAGGAAATCAC
                      ____________________________________________________________
consensus CTGCAGGAAATCAC
 
. : . : . : . : . : . :
rJMSF027N16+ AAACCTTTTACTAACCGG
rJMSF039L24+ GAGATTGATTTTGCCCCGGAAATTGGCGAAACTAAACCCTTTAAACCTTTTACTAAACGG
rJMSF018E19+ ACTAAACGG
                      ____________________________________________________________
consensus GAGATTGATTTTGCCCCGGAAATTGGCGAAACTAAACCCTTTAAACCTTTTACTAAACGG
 
. : . : . : . : . : . :
rJMSF027N16+ TTTCATGTTCCCTATAAAGCATCAAATAGCACTGCTCCTCTTTGGTACTCAATCAAGAGA
rJMSF039L24+ TATCATGTTCCCTATAAAGCATCAGATAGCACTGAAACGTTTTGGTATTCAATCAAGAGA
rJMSF018E19+ TATCATGTTCCCTATAAAGCATCAGATAGCACTGAAACGTTTTGGTATTCAATCAAGAGA
                      ____________________________________________________________
consensus TATCATGTTCCCTATAAAGCATCAGATAGCACTGAAACGTTTTGGTATTCAATCAAGAGA
 
. : . : . : . : . : . :
rJMSF027N16+ GCTTCAGCATATATCATAGTTCTGTCGTCATATTCAGCATATGGCAAATACACCCCTCAA
rJMSF039L24+ GCTTCAGCATATATCATAGTTCTGTCGTCATATTCAGCATATGGAAAATACACCCCTCAA
rJMSF018E19+ GCTTCAGCATATATCATAGTTCTGTCGTCATATTCAGCATATGGAAAATACACCCCTCAA
                      ____________________________________________________________
consensus GCTTCAGCATATATCATAGTTCTGTCGTCATATTCAGCATATGGAAAATACACCCCTCAA
 
. : . : . : . : . : . :
rJMSF027N16+ TACATGTGGCTTAAACAGGAGCTGACAAAAGTTAACAGGAACGAGACACCATGGTTGATT
rJMSF039L24+ TACAAATGGCTTGAAGAGGAGCTGCCAAAAGTTAACAGGACCGAGACACCATGGTTGATT
rJMSF018E19+ TACAAATGGCTTGAAGAGGAGCTGCCAAAAGTTAACAGGACCGAGACACCATGGTTGATT
                      ____________________________________________________________
consensus TACAAATGGCTTGAAGAGGAGCTGCCAAAAGTTAACAGGACCGAGACACCATGGTTGATT
 
. : . : . : . : . : . :
rJMSF027N16+ GTTCTTATGCATGCTCCATGGTACAACAGCTATGACTATCACTATATGGAAGGAGAAACT
rJMSF039L24+ GTTCTTATGCATTCTCCATGGTACAACAGCTATAACTATCACTATATGGAAGGAGAAACT
rJMSF018E19+ GTTCTTATGCATTCTCCATGGTACAACAGCTATAACTATCACTATATGGAAGGAGAAACT
                      ____________________________________________________________
consensus GTTCTTATGCATTCTCCATGGTACAACAGCTATAACTATCACTATATGGAAGGAGAAACT
 
. : . : . : . : . : . :
rJMSF027N16+ ATGAGAGTAATGTACGAGGAATGGTTTGTGGAGCACAAAGTTGATGTTGTTTTTGCTGGT
rJMSF039L24+ ATGAGAGTAATGTTTGAGCCGTGGTTCGTGCAGCACAAAGTCGACCTTGTTTTTGCTGGT
rJMSF018E19+ ATGAGAGTAATGTTTGAGCCGTGGTTCGTGCAGCACAAAGTCGACCTTGTTTTTGCTGGT
                      ____________________________________________________________
consensus ATGAGAGTAATGTTTGAGCCGTGGTTCGTGCAGCACAAAGTCGACCTTGTTTTTGCTGGT
 
. : . : . : . : . : . :
rJMSF027N16+ CATGTTCATGCTTATGAACGCTCGGAGCGCATATCGAATGTGGCGTACAACATTGTAAAT
rJMSF039L24+ CACGTTCATGCTTATGAACGCTCGGAGCGCATATCAAACGTGGCGTACAACATTGTAAAC
rJMSF018E19+ CACGTTCATGCTTATGAACGCTCGGAGCGCATATCAAACGTGGCGTACAACATTGTAAAC
                      ____________________________________________________________
consensus CACGTTCATGCTTATGAACGCTCGGAGCGCATATCAAACGTGGCGTACAACATTGTAAAC
 
. : . : . : . : . : . :
rJMSF027N16+ GGGAAATGCACGCCTGTCCGAAACCAATCTGCCCCTATATACATCACAATTGGTGATGGA
rJMSF039L24+ GGGGAATGCACTCCTGTCCGAGACCAATCTGCCCCAGTATACATCACAATTGGTGATGGA
rJMSF018E19+ GGGGAATGCACTCCTGTCCGAGACCAATCTGCCCCAGTATACATCACAATTGGTGATGGA
                      ____________________________________________________________
consensus GGGGAATGCACTCCTGTCCGAGACCAATCTGCCCCAGTATACATCACAATTGGTGATGGA
 
. : . : . : . : . : . :
rJMSF027N16+ GGAAACCATGAAGGCTTGGCCACCATCATGACAGAACCACAGCCAGAATACTCGGCTTTT
rJMSF039L24+ GGAAATCTTGAAGGCTTGGCCACCAACATGACAGAACCACAGCCAGAATACTCAGCTTTT
rJMSF018E19+ GGAAATCTTGAAGGCTTGGCCACCAACATGACAGAACCACAGCCAGAATACTCAGCTTTT
                      ____________________________________________________________
consensus GGAAATCTTGAAGGCTTGGCCACCAACATGACAGAACCACAGCCAGAATACTCAGCTTTT
 
. : . : . : . : . : . :
rJMSF027N16+ CGCGAGGCGAGTTTTGGGCATGCCACACTTGACATCAAGAACAGAACCCACGCATACTAT
rJMSF039L24+ CGCGAGGCGAGTTTTGGGCATGCCACACTTGACATTAAGAACAGAACCCACGCATACTAT
rJMSF018E19+ CGCGAGGCGAGTTTTGGGCATGCCACACTTGACATTAAGAACAGAACCCACGCATACTAT
                      ____________________________________________________________
consensus CGCGAGGCGAGTTTTGGGCATGCCACACTTGACATTAAGAACAGAACCCACGCATACTAT
 
. : . : . : . : . : . :
rJMSF027N16+ AGCTGGCATTGCAATCAAGATGGATATGCAGTGGAAGCAGATTCAATGTGGGTTTCGAAC
rJMSF039L24+ AGCTGGCATCGCAATCAAGATGGATATGCTGTAGAAGCAGATACAATGTGGGTTTCCAAC
rJMSF018E19+ AGCTGGCATCGCAATCAAGATGGATATGCTGTAGAAGCAGATACAATGTGGGTTTCCAAC
                      ____________________________________________________________
consensus AGCTGGCATCGCAATCAAGATGGATATGCTGTAGAAGCAGATACAATGTGGGTTTCCAAC
 
. : . : . : . : . : . :
rJMSF027N16+ CGAGTTTGGCATCCAGTTGATGATTCTACAACTACCA
rJMSF039L24+ CGATTTTGGCATCCAGTTGATGATTCTACAACTACCAAATTGTGATTGCCACAAGCCACT
rJMSF018E19+ CGATTTTGGCATCCAGTTGATGATTCTACAACTACCAAATTGTGATTGCCACAAGCCACT
                      ____________________________________________________________
consensus CGATTTTGGCATCCAGTTGATGATTCTACAACTACCAAATTGTGATTGCCACAAGCCACT
 
. : . : . : . : . : . :
rJMSF039L24+ TTTTTCACTTGTATCTTTTTGTTTTCTCTGTATTTTAGTGAACTCATGCAGATTAACT
rJMSF018E19+ TTTTTCACTTGTATCTTTTTGTTTTCTCTGTATTTTAGTGAACTCATGCAGATTAACTTT
                      ____________________________________________________________
consensus TTTTTCACTTGTATCTTTTTGTTTTCTCTGTATTTTAGTGAACTCATGCAGATTAACTTT