Previous Contig 012008:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027B19Sequence557001278 (3)pir|T46895|T468955e-64acyl-CoA dehydrogenase (EC 1.3.99.3) [validated] - Arabidopsis thaliana>gb:AB017593012008 (2)pir|T46895|T468951e-71acyl-CoA dehydrogenase (EC 1.3.99.3) [validated] - Arabidopsis thaliana>gb:AB017
JMSF018D18Sequence532001278 (3)pir|T46895|T468958e-61acyl-CoA dehydrogenase (EC 1.3.99.3) [validated] - Arabidopsis thaliana>gb:AB017785012008 (2)pir|T46895|T468953e-98acyl-CoA dehydrogenase (EC 1.3.99.3) [validated] - Arabidopsis thaliana>gb:AB017

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF018D18+ CCAGAT
                      ____________________________________________________________
consensus CCAGAT
 
. : . : . : . : . : . :
rJMSF018D18+ AAANGATTCATAGTAAGAAGAACGTACCAGGANTGCAAGCTACAAAAATGGAAAATAAAA
                      ____________________________________________________________
consensus AAANGATTCATAGTAAGAAGAACGTACCAGGANTGCAAGCTACAAAAATGGAAAATAAAA
 
. : . : . : . : . : . :
rJMSF018D18+ TTGGCCTGAGGATAGTTCAGAATGGAGATATTCTCCTTAACAAAGTTTTTGTACCAGATG
                      ____________________________________________________________
consensus TTGGCCTGAGGATAGTTCAGAATGGAGATATTCTCCTTAACAAAGTTTTTGTACCAGATG
 
. : . : . : . : . : . :
rJMFF027B19+ GAGTAAGGTTCTTGCTGTTTCCA
rJMSF018D18+ AGGACAGGTTACCTGGCGTTAATTCTTTCCAGGATACGAGTAAGGTTCTTGCTGTTT-CA
                      ____________________________________________________________
consensus AGGACAGGTTACCTGGCGTTAATTCTTTCCAGGATACGAGTAAGGTTCTTGCTGTTTCCA
 
. : . : . : . : . : . :
rJMFF027B19+ CGTGTTATGGTGGCCTGGCAACCTATTGGCATTTCGATGGGTGTTTATGATGTTTGCCAC
rJMSF018D18+ CGTGTTATGGTGGCCTGGCAACCTATTGGCATTTCGATGGGTGTTTATGATGTTTGCCAC
                      ____________________________________________________________
consensus CGTGTTATGGTGGCCTGGCAACCTATTGGCATTTCGATGGGTGTTTATGATGTTTGCCAC
 
. : . : . : . : . : . :
rJMFF027B19+ AGGTACTTGAAAGAGAGGAAGCAGTTTGGCGCTCCTCTGGCAGCTTTCCAGATCAACCAA
rJMSF018D18+ AGGTACTTGAAAGAGAGGAAGCAGTTTGGCGCTCCTCTGGCAGCTTTCCAGATCAACCAA
                      ____________________________________________________________
consensus AGGTACTTGAAAGAGAGGAAGCAGTTTGGCGCTCCTCTGGCAGCTTTCCAGATCAACCAA
 
. : . : . : . : . : . :
rJMFF027B19+ CAGAAACTGGTCCAGATGCTGTCAAACATTCAAGCAATGCTTCTTGTTGGGTGGCGGCTT
rJMSF018D18+ CAGAAACTGGTCCAGATGCTGTCAAACATTCAAGCAATGCTTCTTGTTGGGTGGCGGCTT
                      ____________________________________________________________
consensus CAGAAACTGGTCCAGATGCTGTCAAACATTCAAGCAATGCTTCTTGTTGGGTGGCGGCTT
 
. : . : . : . : . : . :
rJMFF027B19+ TGCAAGCTGTACGAGAGTGGTAAAATGACTCCTGGCCATGCGAGCATGGGGAAATCCTGG
rJMSF018D18+ TGCAAGCTGTACGAGAGTGGTAAAATGACTCCTGGCCATGCGAGCATGGGGAAATCCTGG
                      ____________________________________________________________
consensus TGCAAGCTGTACGAGAGTGGTAAAATGACTCCTGGCCATGCGAGCATGGGGAAATCCTGG
 
. : . : . : . : . : . :
rJMFF027B19+ ATTACACTGAAGGCAAGGGAGACTGTTTCACTTGGCCGGGAATTACTAGGAGGCAATGGC
rJMSF018D18+ ATTACACTGAAGGCAAGGGAGACTGTTTCACTTGGCCGGGAATTACTAGGAGGCAATGGC
                      ____________________________________________________________
consensus ATTACACTGAAGGCAAGGGAGACTGTTTCACTTGGCCGGGAATTACTAGGAGGCAATGGC
 
. : . : . : . : . : . :
rJMFF027B19+ ATCTTGACTGACTTTCTAGTAGCAAAGGCGTTTTGCGACTTGGAGCCAATCTACACGTAC
rJMSF018D18+ ATCTTGACTGACTTTCTAGTAGCAAAGGCGTTTTGCGACTTGGAGCCAATCTACACGTAC
                      ____________________________________________________________
consensus ATCTTGACTGACTTTCTAGTAGCAAAGGCGTTTTGCGACTTGGAGCCAATCTACACGTAC
 
. : . : . : . : . : . :
rJMFF027B19+ GAAGGAACCTACGACATCAACACCCTAGTAACAGGCAGAGAAATCACTGGTATTGCAAGC
rJMSF018D18+ GAAGGAACCTACGACATCAACACCCTAGTAACAGGCAGAGAAATCACTGGTATTGCAAGC
                      ____________________________________________________________
consensus GAAGGAACCTACGACATCAACACCCTAGTAACAGGCAGAGAAATCACTGGTATTGCAAGC
 
. : . : . : . : . : . :
rJMFF027B19+ TTTAAGCCTCCTGCTGCTGCTTTGAGTAAAAGGAGTCGCCTATAATCAACTCTTCTTCAT
rJMSF018D18+ TTTAAGCCTCCTGCTGCTGCTTTGAGTAAAAGGAGTCGCCTATAATCAACTCTTCTTCAT
                      ____________________________________________________________
consensus TTTAAGCCTCCTGCTGCTGCTTTGAGTAAAAGGAGTCGCCTATAATCAACTCTTCTTCAT
 
. : . : . : . : . : . :
rJMFF027B19+ TAATAATCCTAGTGTGTGGTTGACTGGTTGGTAGTCCCATTGTGAACTCTGTTGAATAGG
rJMSF018D18+ TAATAATCCTAGTGTGTGGTTGACTGGTTGGTAGTCCCATTGTGAACTCTGTTGAATAGG
                      ____________________________________________________________
consensus TAATAATCCTAGTGTGTGGTTGACTGGTTGGTAGTCCCATTGTGAACTCTGTTGAATAGG
 
. : . : . : . : . : . :
rJMFF027B19+ GAAGGTAAAACATTTACATTTGCACAAGCT
rJMSF018D18+ GAAGGTAAAACATTTACATTTGCACAAGCTGAAACAATAAAGTGCAAAATTACAATTTTT
                      ____________________________________________________________
consensus GAAGGTAAAACATTTACATTTGCACAAGCTGAAACAATAAAGTGCAAAATTACAATTTTT