Previous Contig 012002:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF018B22Sequence453005736 (2)gb:AF009223_17610970.045Pneumocystis carinii kexin-like serine endoprotease mRNA, partial cds.721012002 (2)gb:BT008626_16398374e-43Arabidopsis thaliana clone RAFL09-89-N13 (R19946) unknown protein (At5g65630) mR
JMSF018B23Sequence233005736 (2)732012002 (2)gb:BT008626_16398372e-45Arabidopsis thaliana clone RAFL09-89-N13 (R19946) unknown protein (At5g65630) mR

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF018B23+ CTCGGAACTGTGA
rJMSF018B22+ A
                      ____________________________________________________________
consensus CTCGGAACTGTGA
 
. : . : . : . : . : . :
rJMSF018B23+ AATCAAAACTGGACAGGAATGAGTACAAAACGCCACAAGATTTTGCAGCTGATGTTAGAC
rJMSF018B22+ AATCAAAACTGGACAGGAATGAGTACAAAACGCCACAAGATTTTGCAGCTGATGTTAGAC
                      ____________________________________________________________
consensus AATCAAAACTGGACAGGAATGAGTACAAAACGCCACAAGATTTTGCAGCTGATGTTAGAC
 
. : . : . : . : . : . :
rJMSF018B23+ TGACTTTCAACAATGCTATGATTTATAATCCCAAGGGTGAACAAGTGCATGTCATGGCAG
rJMSF018B22+ TGACTTTCAACAATGCTATGATTTATAATCCCAAGGGTGAACAAGTGCATGTCATGGCAG
                      ____________________________________________________________
consensus TGACTTTCAACAATGCTATGATTTATAATCCCAAGGGTGAACAAGTGCATGTCATGGCAG
 
. : . : . : . : . : . :
rJMSF018B23+ AATTGTTTCTTAATAGCTTTGAAGACATGTTTAAGACTGCATATCAGAACTCTGAGGCTG
rJMSF018B22+ AATTGTTTCTTAATAGCTTTGAAGACATGTTTAAGACTGCATATCAGAACTCTGAGGCTG
                      ____________________________________________________________
consensus AATTGTTTCTTAATAGCTTTGAAGACATGTTTAAGACTGCATATCAGAACTCTGAGGCTG
 
. : . : . : . : . : . :
rJMSF018B23+ AGGATAACAAGGCTGTTGGACCACAGCAAATGACTTGTGATCCCACAGAACAAATTGTGG
rJMSF018B22+ AGGATAACAAGGCTGTTGGACCACAGCAAATGNCTTGTGATCCCACAGAACAAATTGTGG
                      ____________________________________________________________
consensus AGGATAACAAGGCTGTTGGACCACAGCAAATGACTTGTGATCCCACAGAACAAATTGTGG
 
. : . : . : . : . : . :
rJMSF018B23+ AGCCAGGAGCACCTAAGCAAATTCTCATTGCCAAAAAAACCAATTCAGTACCTTCACCAG
rJMSF018B22+ AGCCAGGAGCACCTAAGCAAATTCTCATTGCCAAAAAAACCAATTCAGTACCTTCACCAG
                      ____________________________________________________________
consensus AGCCAGGAGCACCTAAGCAAATTCTCATTGCCAAAAAAACCAATTCAGTACCTTCACCAG
 
. : . : . : . : . : . :
rJMSF018B23+ CAATGGTGTTCAATCCTCCTGTTCCAATCCGAGCTTCGGGTGCAGTTGTTTCGGTGCCTA
rJMSF018B22+ CAATGGTGTTCAATCCTCCTGTTCCAATCCGAGCTTCGGGTGCAGTTGTTTCGGTGCCTA
                      ____________________________________________________________
consensus CAATGGTGTTCAATCCTCCTGTTCCAATCCGAGCTTCGGGTGCAGTTGTTTCGGTGCCTA
 
. : . : . : . : . : . :
rJMSF018B23+ CTGCACTAAAATCTTGTCCACAGCCTGTAGCACCACCCAAGTCAGGGAAATTGCCAAAAC
rJMSF018B22+ CTGCACTAAAATCTTGTCCACAGCCTGTAGCACCACCCAAGTCAGGGAAATTGCCAAAAC
                      ____________________________________________________________
consensus CTGCACTAAAATCTTGTCCACAGCCTGTAGCACCACCCAAGTCAGGGAAATTGCCAAAAC
 
. : . : . : . : . : . :
rJMSF018B23+ CCATGGTTAACAATCCAAACAAGAGGCAGATGACTTTTGAGGAAAAAGCAAAGTTGGGTT
rJMSF018B22+ CCATGGTTAACAATCCAAACAAGAGGCAGATGACTTTTGAGGAAAAAGCAAAGTTGGGTT
                      ____________________________________________________________
consensus CCATGGTTAACAATCCAAACAAGAGGCAGATGACTTTTGAGGAAAAAGCAAAGTTGGGTT
 
. : . : . : . : . : . :
rJMSF018B23+ TGAGCTTGCAGAACCTGCCACAAGAGAAGATGGATCATATGCTGCAAATTTTAAAGAAGA
rJMSF018B22+ TGAGCTTGCAGAACCTGCCACAAGAGAAGATGGATCATATGCTGCAAATTTTAAAGAAGA
                      ____________________________________________________________
consensus TGAGCTTGCAGAACCTGCCACAAGAGAAGATGGATCATATGCTGCAAATTTTAAAGAAGA
 
. : . : . : . : . : . :
rJMSF018B23+ TGAATTTATCTGTGTCAGAGGAGGGTGGTGAGATAGAACTTGACATTCAGGCGCTTGACA
rJMSF018B22+ TGAATTTATCTGTGTCAGAGGAGGGTGGTGAGATAGAACTTGACATTCAGGCGCTNGACA
                      ____________________________________________________________
consensus TGAATTTATCTGTGTCAGAGGAGGGTGGTGAGATAGAACTTGACATTCAGGCGCTTGACA
 
. : . : . : . : . : . :
rJMSF018B23+ ATGAAACACTATGGGAACTACATACATTTGTGGGCTCCCAGAAGAATGCTTTAAGCAATG
rJMSF018B22+ ATGAAACACTATGGGAACTACATACATTTGTGGGCTCCCAGAAGAATGCTTTAAGCAATG
                      ____________________________________________________________
consensus ATGAAACACTATGGGAACTACATACATTTGTGGGCTCCCAGAAGAATGCTTTAAGCAATG
 
. : . : . : . : . : . :
rJMSF018B23+ TGAGCATGCAATGCATGAGTAAAGATGTTTCTGGAGGTTACCCCAATAAAGTAAGAAAA
rJMSF018B22+ TGAGCATGCAATGCATGAGTAAAGATGTTTCTGGAGGTTACCCCAATAAAGTAAGAAAAT
                      ____________________________________________________________
consensus TGAGCATGCAATGCATGAGTAAAGATGTTTCTGGAGGTTACCCCAATAAAGTAAGAAAAT