Previous Contig 012001:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN029N11Sequence616012001 (3)gb:AC137619_17436601e-56Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0095J22, complet
JMSF018B17Sequence231005735 (2)770012001 (3)pir|T48220|T482204e-78hypothetical protein T7H20.40 - Arabidopsis thaliana>gb:ATT7H20_1556414 Arabidop
JMSF032J24Sequence706005735 (2)pir|T48220|T482209e-50hypothetical protein T7H20.40 - Arabidopsis thaliana>gb:ATT7H20_1556414 Arabidop663012001 (3)pir|T48220|T482205e-73hypothetical protein T7H20.40 - Arabidopsis thaliana>gb:ATT7H20_1556414 Arabidop

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN029N11- GAATATTGGAAATGAACCA
                      ____________________________________________________________
consensus GAATATTGGAAATGAACCA
 
. : . : . : . : . : . :
JMFN029N11- CTTGTTCTCATTGCAGCATTATGCCGTGATAAATCAAATCCTTTCGGTGACTCTAATAAG
                      ____________________________________________________________
consensus CTTGTTCTCATTGCAGCATTATGCCGTGATAAATCAAATCCTTTCGGTGACTCTAATAAG
 
. : . : . : . : . : . :
JMFN029N11- TGCTCTCAAGATGGAAATGCATACATCTCATTTGGTCAATGGGTTGGTGCAATTGTCCTG
                      ____________________________________________________________
consensus TGCTCTCAAGATGGAAATGCATACATCTCATTTGGTCAATGGGTTGGTGCAATTGTCCTG
 
. : . : . : . : . : . :
JMFN029N11- TACACCTACGTATTCAATATGCTTGCACCTCCTCCTGAAGGTACCTTTGACATTGAAGAT
                      ____________________________________________________________
consensus TACACCTACGTATTCAATATGCTTGCACCTCCTCCTGAAGGTACCTTTGACATTGAAGAT
 
. : . : . : . : . : . :
JMFN029N11- GGTGGCCACCTTCCAATGAAGGCTCCTAATAGAGATAGCTCCCATGCTGCTGCAAAGGAT
rJMSF018B17+ TTCCAATGAAGGCTCCTAATAGAGATAGCTCCCATGCTGCTGCAAAGGAT
                      ____________________________________________________________
consensus GGTGGCCACCTTCCAATGAAGGCTCCTAATAGAGATAGCTCCCATGCTGCTGCAAAGGAT
 
. : . : . : . : . : . :
JMFN029N11- AGCTCCCCTGAGCAAATTCCATTGCTTGCACAGGAGCCTGCAGTTCCTGTGTCAACTAGT
rJMSF032J24+ TAGT
rJMSF018B17+ AGCTCCCCTGAGCAAATTCCATTGCTTGCACAGGAGCCTGCAGTTCCTGTGTCAACTAGT
                      ____________________________________________________________
consensus AGCTCCCCTGAGCAAATTCCATTGCTTGCACAGGAGCCTGCAGTTCCTGTGTCAACTAGT
 
. : . : . : . : . : . :
JMFN029N11- TCACAGAAAAATAAGATTAAGGAGTTCTTCAAGTTTCTGTATGAAAAATTGAAGCTCAAG
rJMSF032J24+ TCACAGAAAAATAAGATTANGGAGTTCTTCAAGNTTNTGTATGAAAAATTGAAGCTCAAG
rJMSF018B17+ TCACAGAAAAATAAGATTAAGGAGTTCTTCAAGTTTCTGTATGAAAAATTGAAGCTCAAG
                      ____________________________________________________________
consensus TCACAGAAAAATAAGATTAAGGAGTTCTTCAAGTTTCTGTATGAAAAATTGAAGCTCAAG
 
. : . : . : . : . : . :
JMFN029N11- CAAATCATTCAACCCCCCATAATTGCTTCGGTTCTTGCCATTTTCCTAGGATGCGTTCCA
rJMSF032J24+ CAAATCATTCAACCCCCCATAATTGCTTCGGTTCTTGCCATTTTCCTAGGATGCGTTCCA
rJMSF018B17+ CAAATCATTCAACCCCCCATAATTGCTTCGGTTCTTGCCATTTTCCTAGGATGCGTTCCA
                      ____________________________________________________________
consensus CAAATCATTCAACCCCCCATAATTGCTTCGGTTCTTGCCATTTTCCTAGGATGCGTTCCA
 
. : . : . : . : . : . :
JMFN029N11- TTCTTCAAGAAACTGATCTTCACTTCAGATGCTCCATTTTACTTCTTCACTGACAGCTGC
rJMSF032J24+ TTNTTCAAGAAACTGATCTTCACTTCAGATGCTCCATTTTACTTCTTCACTGACAGCTGC
rJMSF018B17+ TTCTTCAAGAAACTGATCTTCACTTCAGATGCTCCATTTTACTTCTTCACTGACAGCTGC
                      ____________________________________________________________
consensus TTCTTCAAGAAACTGATCTTCACTTCAGATGCTCCATTTTACTTCTTCACTGACAGCTGC
 
. : . : . : . : . : . :
JMFN029N11- ATGATTCTTGGGGAGGCCATGATTCCCTGCATATTGTTGGCATTAGGAGGCAATCTTGTT
rJMSF032J24+ ATGATTCTTGGGGAGGCCATGATTCCCTGCATATTGTTGGCATTAGGAGGCAATCTTGTT
rJMSF018B17+ ATGATTCTTGGGGAGGCCATGATTCCCTGCATATTGTTGGCATTAGGAGGCAATCTTGTT
                      ____________________________________________________________
consensus ATGATTCTTGGGGAGGCCATGATTCCCTGCATATTGTTGGCATTAGGAGGCAATCTTGTT
 
. : . : . : . : . : . :
JMFN029N11- CAAGGTCCAGGAAGTTC-AAACTTGGTTTACGGACAACTGCTGCAATCATATTTGGTC
rJMSF032J24+ CAAGGTCCAGGAAGTTCAAAACTTGGTTTACGGACAACTGCTGCAATCATATTTGGTCGG
rJMSF018B17+ CAAGGTCCAGGAAGTTCAAAACTTGGTTTACGGACAACTGCTGCAATCATATTTGGTCGG
                      ____________________________________________________________
consensus CAAGGTCCAGGAAGTTCAAAACTTGGTTTACGGACAACTGCTGCAATCATATTTGGTCGG
 
. : . : . : . : . : . :
rJMSF032J24+ CTGGTTTTAGTTCCTCCAACTGGACTTGGAATCGTCATGTTGGNTGATAAACTCGGCTTC
rJMSF018B17+ CTGGTTTTAGTTCCTCCAACTGGACTTGGAATCGTCATGTTGGCTGATAAACTCGGCTTC
                      ____________________________________________________________
consensus CTGGTTTTAGTTCCTCCAACTGGACTTGGAATCGTCATGTTGGCTGATAAACTCGGCTTC
 
. : . : . : . : . : . :
rJMSF032J24+ CTTCCTGCCGGTGACAAGATGTTCAGATTCGTCCTCCTCCTCCAGCATACAATGCCCACA
rJMSF018B17+ CTTCCTGCCGGTGACAAGATGTTCAGATTCGTCCTCCTCCTCCAGCATACAATGCCCACA
                      ____________________________________________________________
consensus CTTCCTGCCGGTGACAAGATGTTCAGATTCGTCCTCCTCCTCCAGCATACAATGCCCACA
 
. : . : . : . : . : . :
rJMSF032J24+ TCCGTGCTTTCCGGTGCGGTTGCAAATTTGAGAGGGTGTGGGAGGGAGGCAGCTGCTGTC
rJMSF018B17+ TCCGTGCTTTCCGGTGCGGTTGCAAATTTGAGAGGGTGTGGGAGGGAGGCAGCTGCTGTC
                      ____________________________________________________________
consensus TCCGTGCTTTCCGGTGCGGTTGCAAATTTGAGAGGGTGTGGGAGGGAGGCAGCTGCTGTC
 
. : . : . : . : . : . :
rJMSF032J24+ CTGTTTTGGGTTCATATCTTTGCTATTTTCTCAATGGCCGGTTGGATTATCCTGTATCTC
rJMSF018B17+ CTGTTTTGGGTTCATATCTTTGCTATTTTCTCAATGGCCGGTTGGATTATCCTGTATCTC
                      ____________________________________________________________
consensus CTGTTTTGGGTTCATATCTTTGCTATTTTCTCAATGGCCGGTTGGATTATCCTGTATCTC
 
. : . : . : . : . : . :
rJMSF032J24+ AACATATTGTTTTAAGTTTGNACGTAGTTTTGCCAGGAAAATTACCATGCCCAGTGATCA
rJMSF018B17+ AACATATTGTTTTAAGTTTGTACGTAGTTTTGCCAGGAAAATTACCATGCCCAGTGATCA
                      ____________________________________________________________
consensus AACATATTGTTTTAAGTTTGTACGTAGTTTTGCCAGGAAAATTACCATGCCCAGTGATCA
 
. : . : . : . : . : . :
rJMSF032J24+ CTTGTTTATAGAGTAAGCATTATTGCGAGTATCGTTTTCCATAATACATACTNTGAAAT
rJMSF018B17+ CTTGTTTATAGAGTAAGCATTATTGCGAGTATCGTTTTCCATAATACATACTTTGAAATA
                      ____________________________________________________________
consensus CTTGTTTATAGAGTAAGCATTATTGCGAGTATCGTTTTCCATAATACATACTTTGAAATA