Previous Contig 011999:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF018B06Sequence355007777 (3)741011999 (2)gb:AY065010_15661763e-77Arabidopsis thaliana At2g31890/F20M17.7 mRNA, complete cds.>gb:AY129492_1581143
JMSF027K21Sequence658007777 (3)gb:AY065010_15661761e-07Arabidopsis thaliana At2g31890/F20M17.7 mRNA, complete cds.>gb:AY129492_1581143 683011999 (2)gb:AY065010_15661763e-79Arabidopsis thaliana At2g31890/F20M17.7 mRNA, complete cds.>gb:AY129492_1581143

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF027K21+ AGTCTTCAACCGGGATCAGCTTGGAAATATATCTT
rJMSF018B06+ GATCAGCTTGGAAATATATCTT
                      ____________________________________________________________
consensus AGTCTTCAACCGGGATCAGCTTGGAAATATATCTT
 
. : . : . : . : . : . :
rJMSF027K21+ GGTCTTATGCTGTTTTTGGGCAAATGAGTCGAGTTTTCTTCTCCCATGTGTGGAATACTA
rJMSF018B06+ GGTCTTATGCTGTTTTTGGGCAAATGAGTCGAGTTTTCTTCTCCCATGTGTGGAATACTA
                      ____________________________________________________________
consensus GGTCTTATGCTGTTTTTGGGCAAATGAGTCGAGTTTTCTTCTCCCATGTGTGGAATACTA
 
. : . : . : . : . : . :
rJMSF027K21+ TGAGCCAATTTGAGGAACAACACATTTCTGAGCAATACAAGGAGGATATCATGTTTGCTT
rJMSF018B06+ TGAGCCAATTTGAGGAACAACACATTTCTGAGCAATACAAGGAGGATATCATGTTTGCTT
                      ____________________________________________________________
consensus TGAGCCAATTTGAGGAACAACACATTTCTGAGCAATACAAGGAGGATATCATGTTTGCTT
 
. : . : . : . : . : . :
rJMSF027K21+ CTCAAGTTCATCTCGCAAACAAGTGCCTGAAGCTAGAGTACCCAAATCTTCATTTATCTC
rJMSF018B06+ CTCAAGTTCATCTCGCAAACAAGTGCCTGAAGCTAGAGTACCCAAATCTTCATTTATCTC
                      ____________________________________________________________
consensus CTCAAGTTCATCTCGCAAACAAGTGCCTGAAGCTAGAGTACCCAAATCTTCATTTATCTC
 
. : . : . : . : . : . :
rJMSF027K21+ TTGAGGGTGATCTTGAGGAGAAAATTTCTCATGTTGGAAGAACCAAAAGGTTCAATCAGA
rJMSF018B06+ TTGAGGGTGATCTTGAGGAGAAAATTTCTCATGTTGGAAGAACCAAAAGGTTCAATCAGA
                      ____________________________________________________________
consensus TTGAGGGTGATCTTGAGGAGAAAATTTCTCATGTTGGAAGAACCAAAAGGTTCAATCAGA
 
. : . : . : . : . : . :
rJMSF027K21+ GGGTGACCTCTTCCTTTCAGGACGAGGTTGCCCGCCTTCTTGTTAGCACTGGGCTAGATT
rJMSF018B06+ GGGTGACCTCTTCCTTTCAGGACGAGGTTGCCCGCCTTCTTGTTAGCACTGGGCTAGATT
                      ____________________________________________________________
consensus GGGTGACCTCTTCCTTTCAGGACGAGGTTGCCCGCCTTCTTGTTAGCACTGGGCTAGATT
 
. : . : . : . : . : . :
rJMSF027K21+ GGGTAAGAGAATATGATATAGATGGTTACACATTGGATGCAGTTGTGGTTGATAAAAAAA
rJMSF018B06+ GGGTAAGAGAATATGATATAGATGGTTACACATTGGATGCAGTTGTGGTTGATAAAAAAA
                      ____________________________________________________________
consensus GGGTAAGAGAATATGATATAGATGGTTACACATTGGATGCAGTTGTGGTTGATAAAAAAA
 
. : . : . : . : . : . :
rJMSF027K21+ TTGCTCTCGAGATTGATGGTCCAACACATTTCTCTAGAAACTCTGGATCACCGCTGGGAC
rJMSF018B06+ TTGCTCTCGAGATTGATGGTCCAACACATTTCTCTAGAAACTCTGGATCACCGCTGGGAC
                      ____________________________________________________________
consensus TTGCTCTCGAGATTGATGGTCCAACACATTTCTCTAGAAACTCTGGATCACCGCTGGGAC
 
. : . : . : . : . : . :
rJMSF027K21+ ATACAATGCTAAAGCGCCGGTACATAACTGCTGCAGGCTGGAAAATTTTATCTGTTTCTC
rJMSF018B06+ ATACAATGCTAAAGCGCCGGTACATAACTGCTGCAGGCTGGAAAATTTTATCTGTTTCTC
                      ____________________________________________________________
consensus ATACAATGCTAAAGCGCCGGTACATAACTGCTGCAGGCTGGAAAATTTTATCTGTTTCTC
 
. : . : . : . : . : . :
rJMSF027K21+ ACCAGGAATGGGAAAATCTTCAAGGGGGATTCGAGCAGCTAGACTACCTTCGAGAGATTC
rJMSF018B06+ ACCAGGAATGGGAAAATCTTCAAGGGGGATTCGAGCAGCTAGACTACCTTCGAGAGATTC
                      ____________________________________________________________
consensus ACCAGGAATGGGAAAATCTTCAAGGGGGATTCGAGCAGCTAGACTACCTTCGAGAGATTC
 
. : . : . : . : . : . :
rJMSF027K21+ TCAAAGATCACATCTATGAGGGAACAATAATGCCTTGTTAGAGGGAATAAACATAGAATG
rJMSF018B06+ TCAAAGATCACATCTATGAGGGAACAATAATGCCTTGTTAGAGGGAATAAACATAGAATG
                      ____________________________________________________________
consensus TCAAAGATCACATCTATGAGGGAACAATAATGCCTTGTTAGAGGGAATAAACATAGAATG
 
. : . : . : . : . : . :
rJMSF027K21+ ATAATGAAATATTAGTACCTACCAGTTGTATAAGTTGTCTTCTTCAAT
rJMSF018B06+ ATAATGAAATATTAGTACCTA-CAGTTGTATAAGTTGTCTTCTTCAATTTTGATATACAT
                      ____________________________________________________________
consensus ATAATGAAATATTAGTACCTACCAGTTGTATAAGTTGTCTTCTTCAATTTTGATATACAT
 
. : . : . : . : . : . :
rJMSF018B06+ ATTTTTTATTTATGAAAAAATTTTAGGCCCCTCTTTATTGCAATATTCTGTAATCCCTAG
                      ____________________________________________________________
consensus ATTTTTTATTTATGAAAAAATTTTAGGCCCCTCTTTATTGCAATATTCTGTAATCCCTAG